Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing znuC3 gene

Properties
Regulog: Zur - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Built upon 33 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Gardnerella vaginalis 409-05
Position: -117
Score: 5.55319
Sequence: TAATGAGAATCATTATTATTA
Locus tag: HMPREF0424_1241
Name: null
Funciton: surface-anchored protein domain protein
Locus tag: HMPREF0424_1240
Name: null
Funciton: surface-anchored protein domain protein
Locus tag: HMPREF0424_1239
Name: null
Funciton: putative ABC transporter-associated repeat protein
Locus tag: HMPREF0424_1238
Name: znuA3
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: HMPREF0424_1237
Name: znuC3
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: HMPREF0424_1236
Name: znuB3
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
HMPREF0424_1241-HMPREF0424_1240-HMPREF0424_1239-znuA3-znuC3-znuB3 -117 5.6 TAATGAGAATCATTATTATTA HMPREF0424_1241