Regulon of Zur in Bifidobacterium animalis subsp. lactis AD011

Properties
Regulator type:	Transcription factor
TF locus tag:	BLA_1123
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 33 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -100 Score: 6.2 Sequence: TATTGAGAACGATTCTCACTT Locus tag: BLA_0332 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	BLA_0332	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -100 Score: 6.7 Sequence: TATTGAGAATGATTGTCAATA Locus tag: BLA_1501 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: BLA_1502 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	BLA_1501	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	BLA_1502	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -92 Score: 6.2 Sequence: TATTGAGAATCGTTCTCATTT Position: -60 Score: 6 Sequence: TATTGAGAACGATTCCCAATA Locus tag: BLA_0171 Name: zinT Funciton: Candidate zinc-binding lipoprotein ZinT
	BLA_0171	zinT	Candidate zinc-binding lipoprotein ZinT

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD