Regulon of Zur in Bifidobacterium gallicum DSM 20093

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFGAL_01073
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 33 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -285 Score: 5.9 Sequence: TACTGATAATCATTATCAATT Locus tag: BIFGAL_00753 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	BIFGAL_00753	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -103 Score: 6 Sequence: AAATGGGAATGATTGTCAATA Locus tag: BIFGAL_00364 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: BIFGAL_00365 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	BIFGAL_00364	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	BIFGAL_00365	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD