Regulon of Zur in Bifidobacterium bifidum NCIMB 41171

Properties
Regulator type:	Transcription factor
TF locus tag:	BbifN4_010100006451
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 33 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 4.7 Sequence: TATTGAAAATGATTGTAGGAA Locus tag: BbifN4_010100002259 Name: czcD Funciton: Cobalt-zinc-cadmium resistance protein CzcD
	BbifN4_010100002259	czcD	Cobalt-zinc-cadmium resistance protein CzcD
Position: -89 Score: 6 Sequence: TAATGATAATAAATCTCAATA Locus tag: BbifN4_010100006401 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	BbifN4_010100006401	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -101 Score: 5.8 Sequence: TAATGAGAATGATTGTCATAG Locus tag: BbifN4_010100003314 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: BbifN4_010100003309 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	BbifN4_010100003314	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	BbifN4_010100003309	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: 14 Score: 5.6 Sequence: TTTTGATAATGATTATCATTA Locus tag: BbifN4_010100006411 Name: rpmB2 Funciton: LSU ribosomal protein L28p
	BbifN4_010100006411	rpmB2	LSU ribosomal protein L28p

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD