Regulon of Zur in Bifidobacterium longum subsp. infantis ATCC 15697

Properties
Regulator type:	Transcription factor
TF locus tag:	Blon_1974, Blon_1979
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 33 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 5.7 Sequence: TATTGAGAAGCGGTTTCAACT Locus tag: Blon_0841 Name: czcD Funciton: Cobalt-zinc-cadmium resistance protein CzcD
	Blon_0841	czcD	Cobalt-zinc-cadmium resistance protein CzcD
Position: -113 Score: 6.1 Sequence: AAATGATAATAATTCTCAATA Locus tag: Blon_1963 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Blon_1963	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -43 Score: 6.3 Sequence: TATTGAGAACGATTGTCAGCA Locus tag: Blon_1757 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Blon_1758 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Blon_1757	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Blon_1758	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -45 Score: 5.1 Sequence: TAACGATAATGAATATCATTT Locus tag: Blon_1974 Name: zur Funciton: Zinc uptake regulation protein ZUR
	Blon_1974	zur	Zinc uptake regulation protein ZUR
Position: -37 Score: 5.2 Sequence: ATTTGATAATGGTTATCATTA Locus tag: Blon_1965 Name: rpmB2 Funciton: LSU ribosomal protein L28p Locus tag: Blon_1966 Name: rpmG2 Funciton: LSU ribosomal protein L33p
	Blon_1965	rpmB2	LSU ribosomal protein L28p
	Blon_1966	rpmG2	LSU ribosomal protein L33p

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD