Regulog HrcA - Staphylococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | 6 | 2 |
| Staphylococcus capitis SK14 | 6 | 2 |
| Staphylococcus epidermidis ATCC 12228 | 6 | 2 |
| Staphylococcus carnosus subsp. carnosus TM300 | 6 | 2 |
| Staphylococcus haemolyticus JCSC1435 | 6 | 2 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | 6 | 2 |
| Macrococcus caseolyticus JCSC5402 | 6 | 2 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| hrcA |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -38 score = 6.83023 sequence = TTAGCACTTGAGATAAGTGAGTGCTAA Gene: SA1411: heat-inducible transcription repressor HrcA |
*
Staphylococcus capitis SK14 Site: position = -40 score = 7.03093 sequence = TTAGCACTTGAGAGAAAAGAGTGCTAA Gene: STACA0001_1890: heat-inducible transcription repressor HrcA |
*
Staphylococcus epidermidis ATCC 12228 Site: position = -38 score = 7.2182 sequence = TTAGCACTTGAGATAAAAGAGTGCTAA Gene: SE1269: heat-inducible transcription repressor HrcA |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -38 score = 6.79858 sequence = TTAGCACTTGAGAGAAGAGAGTGCTAA Gene: Sca_1204: heat-inducible transcription repressor HrcA |
*
Staphylococcus haemolyticus JCSC1435 Site: position = -40 score = 6.87259 sequence = TTAGCACTTAGGACAAAAGAGTGCTAA Gene: SH1334: heat-inducible transcription repressor HrcA |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -40 score = 6.9778 sequence = TTAGCACTTGAAACAAAAGAGTGCTAA Gene: SSP1175: heat-inducible transcription repressor HrcA |
*
Macrococcus caseolyticus JCSC5402 Site: position = -37 score = 6.88337 sequence = TTAGCACTTGAGGTGATAGAGTGCTAA Gene: MCCL_1234: heat-inducible transcriptional repressor HrcA |
heat-inducible transcription repressor HrcA |
| grpE |
Gene: SA1410: heat shock molecular chaperone protein GrpE |
Gene: STACA0001_1891: heat shock molecular chaperone protein GrpE |
Gene: SE1268: heat shock molecular chaperone protein GrpE |
Gene: Sca_1203: heat shock molecular chaperone protein GrpE |
Gene: SH1335: heat shock molecular chaperone protein GrpE |
Gene: SSP1176: heat shock molecular chaperone protein GrpE |
Gene: MCCL_1233: heat shock molecular chaperone protein GrpE |
heat shock molecular chaperone protein GrpE |
| dnaK |
Gene: SA1409: chaperone protein DnaK |
Gene: STACA0001_1892: chaperone protein DnaK |
Gene: SE1267: chaperone protein DnaK |
Gene: Sca_1202: chaperone protein DnaK |
Gene: SH1336: chaperone protein DnaK |
Gene: SSP1177: chaperone protein DnaK |
Gene: MCCL_1232: chaperone protein DnaK |
chaperone protein DnaK |
| dnaJ |
Gene: SA1408: chaperone protein dnaJ |
Gene: STACA0001_1893: chaperone protein DnaJ |
Gene: SE1266: chaperone protein dnaJ |
Gene: Sca_1201: chaperone protein dnaJ |
Gene: SH1337: chaperone protein dnaJ |
Gene: SSP1178: chaperone protein dnaJ |
Gene: MCCL_1231: chaperone protein DnaJ |
chaperone protein dnaJ |
| CRON 2. | ||||||||
| groES |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -54 score = 6.93658 sequence = TTAGCACTCTTTAATGTTAAGTGCTAA Gene: SA1837: chaperonin GroES protein |
*
Staphylococcus capitis SK14 Site: position = -54 score = 7.17723 sequence = TTAGCACTCTAATAATTAAAGTGCTAA Gene: STACA0001_1993: chaperonin GroES protein |
*
Staphylococcus epidermidis ATCC 12228 Site: position = -54 score = 7.06742 sequence = TTAGCACTCTATATATCAAAGTGCTAA Gene: SE1630: chaperonin GroES protein |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -98 score = 7.59754 sequence = TTAGCACTCAATAATCAAGAGTGCTAA Gene: Sca_1541: chaperonin GroES protein |
*
Staphylococcus haemolyticus JCSC1435 Site: position = -55 score = 7.03253 sequence = TTAGCACTCATTATATTTAAGTGCTAA Gene: SH1001: chaperonin GroES protein |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -56 score = 7.02447 sequence = TTAGCACTCATTAACTTAAAGTGCTAA Gene: SSP0847: chaperonin GroES protein |
*
Macrococcus caseolyticus JCSC5402 Site: position = -61 score = 7.12921 sequence = TTAGCACTATATATAAGAGAGTGCTAA Gene: MCCL_1711: chaperonin GroES protein |
chaperonin GroES protein |
| groEL |
Gene: SA1836: chaperonin GroEL protein |
Gene: STACA0001_1992: chaperonin GroEL protein |
Gene: SE1629: chaperonin GroEL protein |
Gene: Sca_1540: chaperonin GroEL protein |
Gene: SH1002: chaperonin GroEL protein |
Gene: SSP0848: chaperonin GroEL protein |
Gene: MCCL_1710: chaperonin GroEL protein |
chaperonin GroEL protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |