Regulon of HrcA in Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Properties
Regulator type:	Transcription factor
TF locus tag:	SSP1175
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Staphylococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 7 Sequence: TTAGCACTTGAAACAAAAGAGTGCTAA Locus tag: SSP1175 Name: hrcA Funciton: heat-inducible transcription repressor HrcA Locus tag: SSP1176 Name: grpE Funciton: heat shock molecular chaperone protein GrpE Locus tag: SSP1177 Name: dnaK Funciton: chaperone protein DnaK Locus tag: SSP1178 Name: dnaJ Funciton: chaperone protein dnaJ
	SSP1175	hrcA	heat-inducible transcription repressor HrcA
	SSP1176	grpE	heat shock molecular chaperone protein GrpE
	SSP1177	dnaK	chaperone protein DnaK
	SSP1178	dnaJ	chaperone protein dnaJ
Position: -56 Score: 7 Sequence: TTAGCACTCATTAACTTAAAGTGCTAA Locus tag: SSP0847 Name: groES Funciton: chaperonin GroES protein Locus tag: SSP0848 Name: groEL Funciton: chaperonin GroEL protein
	SSP0847	groES	chaperonin GroES protein
	SSP0848	groEL	chaperonin GroEL protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD