Regulon of HrcA in Staphylococcus carnosus subsp. carnosus TM300

Properties
Regulator type:	Transcription factor
TF locus tag:	Sca_1204
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Staphylococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 6.8 Sequence: TTAGCACTTGAGAGAAGAGAGTGCTAA Locus tag: Sca_1204 Name: hrcA Funciton: heat-inducible transcription repressor HrcA Locus tag: Sca_1203 Name: grpE Funciton: heat shock molecular chaperone protein GrpE Locus tag: Sca_1202 Name: dnaK Funciton: chaperone protein DnaK Locus tag: Sca_1201 Name: dnaJ Funciton: chaperone protein dnaJ
	Sca_1204	hrcA	heat-inducible transcription repressor HrcA
	Sca_1203	grpE	heat shock molecular chaperone protein GrpE
	Sca_1202	dnaK	chaperone protein DnaK
	Sca_1201	dnaJ	chaperone protein dnaJ
Position: -98 Score: 7.6 Sequence: TTAGCACTCAATAATCAAGAGTGCTAA Locus tag: Sca_1541 Name: groES Funciton: chaperonin GroES protein Locus tag: Sca_1540 Name: groEL Funciton: chaperonin GroEL protein
	Sca_1541	groES	chaperonin GroES protein
	Sca_1540	groEL	chaperonin GroEL protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD