Regulon of HrcA in Staphylococcus capitis SK14

Properties
Regulator type:	Transcription factor
TF locus tag:	STACA0001_1890
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Staphylococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 7 Sequence: TTAGCACTTGAGAGAAAAGAGTGCTAA Locus tag: STACA0001_1890 Name: hrcA Funciton: heat-inducible transcription repressor HrcA Locus tag: STACA0001_1891 Name: grpE Funciton: heat shock molecular chaperone protein GrpE Locus tag: STACA0001_1892 Name: dnaK Funciton: chaperone protein DnaK Locus tag: STACA0001_1893 Name: dnaJ Funciton: chaperone protein DnaJ
	STACA0001_1890	hrcA	heat-inducible transcription repressor HrcA
	STACA0001_1891	grpE	heat shock molecular chaperone protein GrpE
	STACA0001_1892	dnaK	chaperone protein DnaK
	STACA0001_1893	dnaJ	chaperone protein DnaJ
Position: -54 Score: 7.2 Sequence: TTAGCACTCTAATAATTAAAGTGCTAA Locus tag: STACA0001_1993 Name: groES Funciton: chaperonin GroES protein Locus tag: STACA0001_1992 Name: groEL Funciton: chaperonin GroEL protein
	STACA0001_1993	groES	chaperonin GroES protein
	STACA0001_1992	groEL	chaperonin GroEL protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD