Regulon of HrcA in Macrococcus caseolyticus JCSC5402

Properties
Regulator type:	Transcription factor
TF locus tag:	MCCL_1234
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Staphylococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.9 Sequence: TTAGCACTTGAGGTGATAGAGTGCTAA Locus tag: MCCL_1234 Name: hrcA Funciton: heat-inducible transcriptional repressor HrcA Locus tag: MCCL_1233 Name: grpE Funciton: heat shock molecular chaperone protein GrpE Locus tag: MCCL_1232 Name: dnaK Funciton: chaperone protein DnaK Locus tag: MCCL_1231 Name: dnaJ Funciton: chaperone protein DnaJ
	MCCL_1234	hrcA	heat-inducible transcriptional repressor HrcA
	MCCL_1233	grpE	heat shock molecular chaperone protein GrpE
	MCCL_1232	dnaK	chaperone protein DnaK
	MCCL_1231	dnaJ	chaperone protein DnaJ
Position: -61 Score: 7.1 Sequence: TTAGCACTATATATAAGAGAGTGCTAA Locus tag: MCCL_1711 Name: groES Funciton: chaperonin GroES protein Locus tag: MCCL_1710 Name: groEL Funciton: chaperonin GroEL protein
	MCCL_1711	groES	chaperonin GroES protein
	MCCL_1710	groEL	chaperonin GroEL protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD