Regulon of HrcA in Staphylococcus epidermidis ATCC 12228

Properties
Regulator type:	Transcription factor
TF locus tag:	SE1269
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Staphylococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 7.2 Sequence: TTAGCACTTGAGATAAAAGAGTGCTAA Locus tag: SE1269 Name: hrcA Funciton: heat-inducible transcription repressor HrcA Locus tag: SE1268 Name: grpE Funciton: heat shock molecular chaperone protein GrpE Locus tag: SE1267 Name: dnaK Funciton: chaperone protein DnaK Locus tag: SE1266 Name: dnaJ Funciton: chaperone protein dnaJ
	SE1269	hrcA	heat-inducible transcription repressor HrcA
	SE1268	grpE	heat shock molecular chaperone protein GrpE
	SE1267	dnaK	chaperone protein DnaK
	SE1266	dnaJ	chaperone protein dnaJ
Position: -54 Score: 7.1 Sequence: TTAGCACTCTATATATCAAAGTGCTAA Locus tag: SE1630 Name: groES Funciton: chaperonin GroES protein Locus tag: SE1629 Name: groEL Funciton: chaperonin GroEL protein
	SE1630	groES	chaperonin GroES protein
	SE1629	groEL	chaperonin GroEL protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD