Regulon of HrcA in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type:	Transcription factor
TF locus tag:	SA1411
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Staphylococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 6.9 Sequence: TTAGCACTCTTTAATGTTAAGTGCTAA Locus tag: SA1837 Name: groES Funciton: chaperonin GroES protein Locus tag: SA1836 Name: groEL Funciton: chaperonin GroEL protein
	SA1837	groES	chaperonin GroES protein
	SA1836	groEL	chaperonin GroEL protein
Position: -38 Score: 6.8 Sequence: TTAGCACTTGAGATAAGTGAGTGCTAA Locus tag: SA1411 Name: hrcA Funciton: heat-inducible transcription repressor HrcA Locus tag: SA1410 Name: grpE Funciton: heat shock molecular chaperone protein GrpE Locus tag: SA1409 Name: dnaK Funciton: chaperone protein DnaK Locus tag: SA1408 Name: dnaJ Funciton: chaperone protein dnaJ
	SA1411	hrcA	heat-inducible transcription repressor HrcA
	SA1410	grpE	heat shock molecular chaperone protein GrpE
	SA1409	dnaK	chaperone protein DnaK
	SA1408	dnaJ	chaperone protein dnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD