Regulon of HrcA in Staphylococcus haemolyticus JCSC1435

Properties
Regulator type:	Transcription factor
TF locus tag:	SH1334
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Staphylococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 7 Sequence: TTAGCACTCATTATATTTAAGTGCTAA Locus tag: SH1001 Name: groES Funciton: chaperonin GroES protein Locus tag: SH1002 Name: groEL Funciton: chaperonin GroEL protein
	SH1001	groES	chaperonin GroES protein
	SH1002	groEL	chaperonin GroEL protein
Position: -40 Score: 6.9 Sequence: TTAGCACTTAGGACAAAAGAGTGCTAA Locus tag: SH1334 Name: hrcA Funciton: heat-inducible transcription repressor HrcA Locus tag: SH1335 Name: grpE Funciton: heat shock molecular chaperone protein GrpE Locus tag: SH1336 Name: dnaK Funciton: chaperone protein DnaK Locus tag: SH1337 Name: dnaJ Funciton: chaperone protein dnaJ
	SH1334	hrcA	heat-inducible transcription repressor HrcA
	SH1335	grpE	heat shock molecular chaperone protein GrpE
	SH1336	dnaK	chaperone protein DnaK
	SH1337	dnaJ	chaperone protein dnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD