Statistics of regulated genes

Genome	Genes	Operons
Pyrococcus abyssi GE5	11	9
Pyrococcus furiosus DSM 3638	17	14
Pyrococcus horikoshii OT3	11	9
Thermococcus gammatolerans EJ3	17	13
Thermococcus kodakaraensis KOD1	16	14
Thermococcus onnurineus NA1	11	8
Thermococcus sibiricus MM 739	13	10

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes								Function
CRON 1.
pfdA	Pyrococcus abyssi GE5	Pyrococcus furiosus DSM 3638	Pyrococcus horikoshii OT3	* Thermococcus gammatolerans EJ3 Site: position = -25 score = 6.12821 sequence = TTTAAATACAAAAGGTAACTAAA Gene: TGAM_1373: Prefoldin, alpha subunit	* Thermococcus kodakaraensis KOD1 Site: position = -59 score = 5.19327 sequence = TTTAAATACCAAAAGTTATTTTA Site: position = -43 score = 5.05798 sequence = TATTTTAACAATGGGTAAGAAAA Gene: TK1121: Prefoldin, alpha subunit	Thermococcus onnurineus NA1	Thermococcus sibiricus MM 739	Prefoldin, alpha subunit
pfdB	Pyrococcus abyssi GE5	Pyrococcus furiosus DSM 3638	Pyrococcus horikoshii OT3	Thermococcus gammatolerans EJ3 Gene: TGAM_1374: Prefoldin, beta subunit	Thermococcus kodakaraensis KOD1 Gene: TK1122: Prefoldin, beta subunit	Thermococcus onnurineus NA1	Thermococcus sibiricus MM 739	Prefoldin, beta subunit
CRON 2.
cas2	Pyrococcus abyssi GE5	* Pyrococcus furiosus DSM 3638 Site: position = -164 score = 4.72132 sequence = TTTCGTAACAAGTAAATAGTAAA Site: position = -125 score = 5.0125 sequence = AATACTAACTTTGAGTTACTAAA Gene: PF1117: CRISPR-associated protein Cas2	Pyrococcus horikoshii OT3 Gene: PH0173.1n: CRISPR-associated protein Cas2	Thermococcus gammatolerans EJ3 Gene: TGAM_1299: CRISPR-associated protein Cas2	* Thermococcus kodakaraensis KOD1 Site: position = -157 score = 4.99073 sequence = GATAGTAACCAAACGTTACTAAA Gene: TK0445: CRISPR-associated protein Cas2	* Thermococcus onnurineus NA1 Site: position = -164 score = 5.24062 sequence = GATAATTACTTTATGTTACTAAA Gene: TON_0320: CRISPR-associated protein Cas2	* Thermococcus sibiricus MM 739 Site: position = -120 score = 4.92257 sequence = TTTCAAAACCAAAAGTTAAAAAC Gene: TSIB_1494: CRISPR-associated protein Cas2	CRISPR-associated protein Cas2
CRON 3.
PF1931	* Pyrococcus abyssi GE5 Site: position = -52 score = 5.13148 sequence = TATAGTATCATGAAGTTAGTAAA Gene: PAB2180: RecA-superfamily ATPase	* Pyrococcus furiosus DSM 3638 Site: position = -54 score = 4.6303 sequence = TATAGTATATTGAAGTTAGTAAA Gene: PF1931: RecA-superfamily ATPase	* Pyrococcus horikoshii OT3 Site: position = -37 score = 5.11261 sequence = TATAGTATCATGAAGTTAATAAA Gene: PH0284: RecA-superfamily ATPase	* Thermococcus gammatolerans EJ3 Site: position = -36 score = 5.04386 sequence = AATGGTAACTAAAAGTTACTAAA Gene: TGAM_0280: RecA-superfamily ATPase	Thermococcus kodakaraensis KOD1 Gene: TK1590: RecA-superfamily ATPase	* Thermococcus onnurineus NA1 Site: position = -37 score = 5.55184 sequence = ATTGGTAACAAAAGGTAACTAAA Gene: TON_1740: RecA-superfamily ATPase	* Thermococcus sibiricus MM 739 Site: position = -83 score = 5.42485 sequence = TATACTACCAATTGGTAATTAAA Gene: TSIB_1804: RecA-superfamily ATPase	RecA-superfamily ATPase
PF1932	Pyrococcus abyssi GE5 Gene: PAB2181: Conserved hypothetical protein	Pyrococcus furiosus DSM 3638 Gene: PF1932: Conserved hypothetical protein	Pyrococcus horikoshii OT3 Gene: PH0283: Conserved hypothetical protein	Thermococcus gammatolerans EJ3 Gene: TGAM_0281: Conserved hypothetical protein	Thermococcus kodakaraensis KOD1 Gene: TK1591: Conserved hypothetical protein	Thermococcus onnurineus NA1 Gene: TON_1741: Conserved hypothetical protein	Thermococcus sibiricus MM 739 Gene: TSIB_1803: Conserved hypothetical protein	Conserved hypothetical protein
CRON 4.
PF1050	Pyrococcus abyssi GE5 Gene: PAB0743: Conserved hypothetical protein	Pyrococcus furiosus DSM 3638 Gene: PF1050: Conserved hypothetical protein	Pyrococcus horikoshii OT3 Gene: PH1112: Conserved hypothetical protein	* Thermococcus gammatolerans EJ3 Site: position = -72 score = 6.12821 sequence = TTTAGTTACCTTTTGTATTTAAA Gene: TGAM_1372: Conserved hypothetical protein	* Thermococcus kodakaraensis KOD1 Site: position = -84 score = 5.05798 sequence = TTTTCTTACCCATTGTTAAAATA Site: position = -68 score = 5.19327 sequence = TAAAATAACTTTTGGTATTTAAA Gene: TK1120: Conserved hypothetical protein	Thermococcus onnurineus NA1 Gene: TON_0581: Conserved hypothetical protein	* Thermococcus sibiricus MM 739 Site: position = -172 score = 5.02081 sequence = TTTGTACACTTTTGGTTACTAAC Site: position = -158 score = 4.58721 sequence = GTTACTAACTTTGGGTTTATAAC Gene: TSIB_1463: Conserved hypothetical protein	Conserved hypothetical protein
CRON 5.
PF0239	Pyrococcus abyssi GE5 Gene: PAB1112: Conserved hypothetical protein	* Pyrococcus furiosus DSM 3638 Site: position = -18 score = 5.24616 sequence = TTTAGTTACCTATTGTAAATGAT Gene: PF0239: Conserved hypothetical protein	* Pyrococcus horikoshii OT3 Site: position = -18 score = 5.30584 sequence = TTTAGTTACCTTAGGTAAATGAT Gene: PHS059: Conserved hypothetical protein	* Thermococcus gammatolerans EJ3 Site: position = -42 score = 4.59985 sequence = TTTAGTAACAATTCTTTAGGATA Gene: TGAM_0090: Conserved hypothetical protein	* Thermococcus kodakaraensis KOD1 Site: position = -45 score = 5.87012 sequence = TTTAGTTACAATTTTTTATTAAA Gene: TK2131: Conserved hypothetical protein	* Thermococcus onnurineus NA1 Site: position = -35 score = 5.25688 sequence = TTTAGTAACAATTCTTTAGAAAA Gene: TON_1528: Conserved hypothetical protein	* Thermococcus sibiricus MM 739 Site: position = -23 score = 5.38842 sequence = TTTAGTTACTGATTCTTATTAAA Gene: TSIB_0908: Conserved hypothetical protein	Conserved hypothetical protein
CRON 6.
PF0015	Pyrococcus abyssi GE5 Gene: PAB0075: Predicted chaperone	* Pyrococcus furiosus DSM 3638 Site: position = -41 score = 5.99709 sequence = TTTAATAACCTTTTGGAACTAAA Gene: PF0015: Predicted chaperone	Pyrococcus horikoshii OT3 Gene: PH0126: Predicted chaperone	* Thermococcus gammatolerans EJ3 Site: position = -43 score = 5.92603 sequence = TTTAATAACCTTTTGGAAATAAA Gene: TGAM_0133: Predicted chaperone	* Thermococcus kodakaraensis KOD1 Site: position = -42 score = 6.1766 sequence = TTTAATAACCTTTGGAAACTAAA Gene: TK1896: Predicted chaperone	* Thermococcus onnurineus NA1 Site: position = -42 score = 6.13578 sequence = TTTAATAACCTTTAGAAACTAAA Gene: TON_1650: Predicted chaperone	* Thermococcus sibiricus MM 739 Site: position = -41 score = 5.91711 sequence = TTTAATAACCTATAATTACTAAA Gene: TSIB_1989: Predicted chaperone	Predicted chaperone
PF0014	Pyrococcus abyssi GE5 Gene: PAB0076: Conserved hypothetical protein	Pyrococcus furiosus DSM 3638 Gene: PF0014: Conserved hypothetical protein	Pyrococcus horikoshii OT3 Gene: PH0127: Conserved hypothetical protein	Thermococcus gammatolerans EJ3 Gene: TGAM_0132: Conserved hypothetical protein	Thermococcus kodakaraensis KOD1 Gene: TK1897: Conserved hypothetical protein	Thermococcus onnurineus NA1 Gene: TON_1649: Conserved hypothetical protein	Thermococcus sibiricus MM 739 Gene: TSIB_1990: Conserved hypothetical protein	Conserved hypothetical protein
CRON 7.
tip49	* Pyrococcus abyssi GE5 Site: position = -38 score = 5.71638 sequence = TTTAATAACCATTTGGAAGAAAA Gene: PAB2107: TBP-interacting protein TIP49	* Pyrococcus furiosus DSM 3638 Site: position = -42 score = 5.66707 sequence = TTTAATAACAAAATGGAACAAAA Gene: PF1847: TBP-interacting protein TIP49	* Pyrococcus horikoshii OT3 Site: position = -38 score = 5.85121 sequence = TTTAATTACTAAATGGAAATAAA Gene: PH1804: TBP-interacting protein TIP49	* Thermococcus gammatolerans EJ3 Site: position = -48 score = 4.84193 sequence = TTTAGTTACCTTTGGATAGATTA Gene: TGAM_1545: TBP-interacting protein TIP49	* Thermococcus kodakaraensis KOD1 Site: position = -42 score = 5.04858 sequence = TTTAGTAACCTTCGGTATTCTAA Gene: TK1199: TBP-interacting protein TIP49	Thermococcus onnurineus NA1 Gene: TON_0462: TBP-interacting protein TIP49	* Thermococcus sibiricus MM 739 Site: position = -45 score = 5.91437 sequence = TTTAAATACCAATAGTTTCTAAA Gene: TSIB_1591: TBP-interacting protein TIP49	TBP-interacting protein TIP49
CRON 8.
hsp20	* Pyrococcus abyssi GE5 Site: position = -43 score = 6.24803 sequence = TTTAATTACTATTGGTAACAAAA Gene: PAB2072: Small heat shock protein 20	* Pyrococcus furiosus DSM 3638 Site: position = -43 score = 6.25215 sequence = TTTAATAACTAATGGTAACCAAA Gene: PF1883: Small heat shock protein 20	* Pyrococcus horikoshii OT3 Site: position = -24 score = 6.24 sequence = TTTAGTAACTAATGGTAACCAAA Gene: PH1842: Small heat shock protein 20	* Thermococcus gammatolerans EJ3 Site: position = -99 score = 5.02724 sequence = TTTAGTCACCTTTTGTATGGTAA Site: position = -50 score = 5.90851 sequence = TTTAGTAACTACTGGTAACCAAA Gene: TGAM_1688: Small heat shock protein 20	* Thermococcus kodakaraensis KOD1 Site: position = -73 score = 4.9165 sequence = TTTGGTAACTTTCGGAGAGAAAA Site: position = -32 score = 5.99886 sequence = TTTAATAACAATTGGTGAGAAAA Gene: TK1155: Small heat shock protein 20	* Thermococcus onnurineus NA1 Site: position = -41 score = 5.8745 sequence = TTTAGTTACTACTGGTAACCAAA Gene: TON_1113: Small heat shock protein 20	* Thermococcus sibiricus MM 739 Site: position = -11 score = 6.25215 sequence = TTTAATAACTATTGGTAACCAAA Gene: TSIB_0520: Small heat shock protein 20	Small heat shock protein 20
vat	* Pyrococcus abyssi GE5 Site: position = -40 score = 6.12358 sequence = TTTAGTAACCATTGGTAAAGAAA Gene: PAB2086: ATPase, AAA+ family	* Pyrococcus furiosus DSM 3638 Site: position = -41 score = 6.29297 sequence = TTTAGTAACCATTGGTAATCAAA Gene: PF1882: ATPase, AAA+ family	* Pyrococcus horikoshii OT3 Site: position = -30 score = 6.19883 sequence = TTTAGTAACCATTAGTAAAAAAA Gene: PH1840: ATPase, AAA+ family	Thermococcus gammatolerans EJ3 Gene: TGAM_1689: ATPase, AAA+ family	* Thermococcus kodakaraensis KOD1 Site: position = -91 score = 4.65083 sequence = TTTGGTAACCTCACTTAAGAAAA Site: position = -41 score = 5.78409 sequence = TTTAGTAACTTACGGTAACCAAA Gene: TK1157: ATPase, AAA+ family	Thermococcus onnurineus NA1 Gene: TON_1114: ATPase, AAA+ family	Thermococcus sibiricus MM 739 Gene: TSIB_0521: ATPase, AAA+ family	ATPase, AAA+ family
CRON 9.
phr	* Pyrococcus abyssi GE5 Site: position = -55 score = 5.6309 sequence = TTTTCTAACATTGGGTTAGAAAA Gene: PAB0208: Heat shock response regulator Phr, ArsR family	* Pyrococcus furiosus DSM 3638 Site: position = -44 score = 6.0242 sequence = TTTACTTACAATATGTTAGAAAA Gene: PF1790: Heat shock response regulator Phr, ArsR family	Pyrococcus horikoshii OT3 Gene: PH1744: Heat shock response regulator Phr, ArsR family	* Thermococcus gammatolerans EJ3 Site: position = -41 score = 5.53612 sequence = TTTTCTAACATTAAGTTAGTAAG Gene: TGAM_0854: Heat shock response regulator Phr, ArsR family	* Thermococcus kodakaraensis KOD1 Site: position = -37 score = 5.32412 sequence = TTTACTAACTTTGGGTTAGGGAA Gene: TK2291: Heat shock response regulator Phr, ArsR family	* Thermococcus onnurineus NA1 Site: position = -41 score = 5.19765 sequence = TTTTCTTACATTAAGTTAGGGAA Gene: TON_1231: Heat shock response regulator Phr, ArsR family	* Thermococcus sibiricus MM 739 Site: position = -48 score = 5.04413 sequence = TTTATTTACATTAGGTTAGATTA Gene: TSIB_1608: Heat shock response regulator Phr, ArsR family	Heat shock response regulator Phr, ArsR family
CRON 10.
inoS	Pyrococcus abyssi GE5 Gene: PAB1989: Inositol-1-phosphate synthase (EC 5.5.1.4)	* Pyrococcus furiosus DSM 3638 Site: position = -119 score = 5.16363 sequence = TTTATAAACCAAAGTTACTTAAA Site: position = -66 score = 5.03016 sequence = TTTTGTCTATAAAAGTTAATAAA Gene: PF1616: Inositol-1-phosphate synthase (EC 5.5.1.4)	Pyrococcus horikoshii OT3 Gene: PH1605: Inositol-1-phosphate synthase (EC 5.5.1.4)	Thermococcus gammatolerans EJ3 Gene: TGAM_1848: Inositol-1-phosphate synthase (EC 5.5.1.4)	Thermococcus kodakaraensis KOD1 Gene: TK2278: Inositol-1-phosphate synthase (EC 5.5.1.4)	Thermococcus onnurineus NA1 Gene: TON_1249: Inositol-1-phosphate synthase (EC 5.5.1.4)	Thermococcus sibiricus MM 739 Gene: TSIB_1788: Inositol-1-phosphate synthase (EC 5.5.1.4)	Inositol-1-phosphate synthase (EC 5.5.1.4)
CRON 11.
PF1488	* Pyrococcus abyssi GE5 Site: position = -24 score = 6.26716 sequence = TTTAATAACTAAAGGTGAGTAAA Gene: PAB1806: Conserved hypothetical protein	* Pyrococcus furiosus DSM 3638 Site: position = -59 score = 5.0452 sequence = TTTTCTCACCAAATGATTTAAAA Site: position = -25 score = 5.86393 sequence = TTTAATAACAAATGGTGAAGAAA Gene: PF1488: Conserved hypothetical protein	* Pyrococcus horikoshii OT3 Site: position = -14 score = 6.29172 sequence = TTTAATAACAATAGGTGATTAAA Gene: PH1314: Conserved hypothetical protein	* Thermococcus gammatolerans EJ3 Site: position = -23 score = 6.0124 sequence = TTTAATAACAAAAGGTGATCAAA Gene: TGAM_0505: Conserved hypothetical protein	* Thermococcus kodakaraensis KOD1 Site: position = -23 score = 5.94248 sequence = TTTACTAACCTTTGGTGATGAAA Gene: TK2294: Conserved hypothetical protein	Thermococcus onnurineus NA1	Thermococcus sibiricus MM 739	Conserved hypothetical protein
PF1489	Pyrococcus abyssi GE5 Gene: PAB1807: Conserved hypothetical protein	Pyrococcus furiosus DSM 3638 Gene: PF1489: Conserved hypothetical protein	Pyrococcus horikoshii OT3 Gene: PH1315: Conserved hypothetical protein	Thermococcus gammatolerans EJ3	Thermococcus kodakaraensis KOD1	Thermococcus onnurineus NA1	Thermococcus sibiricus MM 739	Conserved hypothetical protein
CRON 12.
impD	* Pyrococcus abyssi GE5 Site: position = -92 score = 5.79411 sequence = TTTATTAACCTTTTCTTACTAAA Gene: PAB0961: Inosine monophosphate dehydrogenase	* Pyrococcus furiosus DSM 3638 Site: position = -93 score = 5.9612 sequence = TTTATTAACCAAAGTTTACTAAA Gene: PF0321: Inosine monophosphate dehydrogenase	* Pyrococcus horikoshii OT3 Site: position = -90 score = 5.54712 sequence = TTTATTAACCTTTCTTTACTAAA Site: position = -47 score = 4.9783 sequence = TTTAAATTCCAAGGGAGAGTAAA Gene: PH0600: Inosine monophosphate dehydrogenase	* Thermococcus gammatolerans EJ3 Site: position = -89 score = 5.57478 sequence = TTTATTAACCTGAGTTAACTAAA Gene: TGAM_0730: Inosine monophosphate dehydrogenase	* Thermococcus kodakaraensis KOD1 Site: position = -93 score = 5.58724 sequence = TTTATTAACCTAACGTTACTTAA Gene: TK1186: Inosine monophosphate dehydrogenase	* Thermococcus onnurineus NA1 Site: position = -95 score = 5.4922 sequence = TTTATTAACCTAACTTAACTAAA Gene: TON_0361: Inosine monophosphate dehydrogenase	* Thermococcus sibiricus MM 739 Site: position = -85 score = 6.25477 sequence = TTTATTAACTTAATGTAAATAAA Gene: TSIB_1314: Inosine monophosphate dehydrogenase	Inosine monophosphate dehydrogenase
CRON 13.
PF1291	* Pyrococcus abyssi GE5 Site: position = -38 score = 5.6218 sequence = TTTAGTTAATTTTGGTAAGAAAA Gene: PAB1723: Putative metallophosphoesterase	* Pyrococcus furiosus DSM 3638 Site: position = -39 score = 5.6218 sequence = TTTAGTTAATTTTGGTAAGAAAA Gene: PF1291: Putative metallophosphoesterase	* Pyrococcus horikoshii OT3 Site: position = -38 score = 5.6218 sequence = TTTAGTTAATTTTGGTAAGAAAA Gene: PH1004: Putative metallophosphoesterase	* Thermococcus gammatolerans EJ3 Site: position = -38 score = 5.76708 sequence = TTTAGTTTCTTTAGGTAAGAAAA Gene: TGAM_1955: Putative metallophosphoesterase	* Thermococcus kodakaraensis KOD1 Site: position = -38 score = 5.36453 sequence = TTTATTTTCTTCAGGTAAGAAAA Gene: TK1492: Putative metallophosphoesterase	* Thermococcus onnurineus NA1 Site: position = -36 score = 5.32251 sequence = TTTAGTTAATTTGAGTAAGAAAA Gene: TON_0117: Putative metallophosphoesterase	Thermococcus sibiricus MM 739	Putative metallophosphoesterase
CRON 14.
PF1042	* Pyrococcus abyssi GE5 Site: position = -38 score = 6.09013 sequence = TTTAAATACTTTTAGTTAATAAA Gene: PAB0736: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)	* Pyrococcus furiosus DSM 3638 Site: position = -38 score = 5.82353 sequence = TTTAAGCACTAAAAGTTATTAAA Gene: PF1042: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)	* Pyrococcus horikoshii OT3 Site: position = -39 score = 6.13356 sequence = TTTAAATACATTTAGTTATTAAA Gene: PH1122: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)	* Thermococcus gammatolerans EJ3 Site: position = -33 score = 5.96279 sequence = TTTAAGAACAAAAAGTAACTAAA Gene: TGAM_1491: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)	* Thermococcus kodakaraensis KOD1 Site: position = -53 score = 6.09378 sequence = TTTAAATACAAAATGTTATTAAA Gene: TK1097: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)	Thermococcus onnurineus NA1	Thermococcus sibiricus MM 739	Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
CRON 15.
PF0624	Pyrococcus abyssi GE5	* Pyrococcus furiosus DSM 3638 Site: position = -45 score = 6.03819 sequence = TTTATATACTTTTTGTTACTAAA Gene: PF0624: Conserved hypothetical protein	Pyrococcus horikoshii OT3	* Thermococcus gammatolerans EJ3 Site: position = -55 score = 5.62275 sequence = TTTATATACTCTGGGTTACTAAA Gene: TGAM_0933: Conserved hypothetical protein	* Thermococcus kodakaraensis KOD1 Site: position = -56 score = 5.86031 sequence = TTTATATACTCAAGGTTACTAAA Gene: TK0750: Conserved hypothetical protein	Thermococcus onnurineus NA1	* Thermococcus sibiricus MM 739 Site: position = -62 score = 6.00418 sequence = TTTATATACTTATTGTAACTAAA Gene: TSIB_0871: Conserved hypothetical protein	Conserved hypothetical protein

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD