Regulon of Phr in Pyrococcus abyssi GE5

Properties
Regulator type:	Transcription factor
TF locus tag:	PAB0208
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Thermococcales
Statistics of regulated genes:
- Genes	11
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 87 sites [see more]

Member of regulog collections

By taxonomy - Thermococcales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 5.1 Sequence: TATAGTATCATGAAGTTAGTAAA Locus tag: PAB2180 Name: PF1931 Funciton: RecA-superfamily ATPase Locus tag: PAB2181 Name: PF1932 Funciton: Conserved hypothetical protein
	PAB2180	PF1931	RecA-superfamily ATPase
	PAB2181	PF1932	Conserved hypothetical protein
Position: -38 Score: 6.1 Sequence: TTTAAATACTTTTAGTTAATAAA Locus tag: PAB0736 Name: PF1042 Funciton: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
	PAB0736	PF1042	Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
Position: -55 Score: 5.6 Sequence: TTTTCTAACATTGGGTTAGAAAA Locus tag: PAB0208 Name: phr Funciton: Heat shock response regulator Phr, ArsR family
	PAB0208	phr	Heat shock response regulator Phr, ArsR family
Position: -38 Score: 5.7 Sequence: TTTAATAACCATTTGGAAGAAAA Locus tag: PAB2107 Name: tip49 Funciton: TBP-interacting protein TIP49
	PAB2107	tip49	TBP-interacting protein TIP49
Position: -40 Score: 6.1 Sequence: TTTAGTAACCATTGGTAAAGAAA Locus tag: PAB2086 Name: vat Funciton: ATPase, AAA+ family
	PAB2086	vat	ATPase, AAA+ family
Position: -43 Score: 6.2 Sequence: TTTAATTACTATTGGTAACAAAA Locus tag: PAB2072 Name: hsp20 Funciton: Small heat shock protein 20
	PAB2072	hsp20	Small heat shock protein 20
Position: -92 Score: 5.8 Sequence: TTTATTAACCTTTTCTTACTAAA Locus tag: PAB0961 Name: impD Funciton: Inosine monophosphate dehydrogenase
	PAB0961	impD	Inosine monophosphate dehydrogenase
Position: -24 Score: 6.3 Sequence: TTTAATAACTAAAGGTGAGTAAA Locus tag: PAB1806 Name: PF1488 Funciton: Conserved hypothetical protein Locus tag: PAB1807 Name: PF1489 Funciton: Conserved hypothetical protein
	PAB1806	PF1488	Conserved hypothetical protein
	PAB1807	PF1489	Conserved hypothetical protein
Position: -38 Score: 5.6 Sequence: TTTAGTTAATTTTGGTAAGAAAA Locus tag: PAB1723 Name: PF1291 Funciton: Putative metallophosphoesterase
	PAB1723	PF1291	Putative metallophosphoesterase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Phr in Pyrococcus abyssi GE5

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --