Regulon of Phr in Pyrococcus horikoshii OT3

Properties
Regulator type:	Transcription factor
TF locus tag:	PH1744
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Thermococcales
Statistics of regulated genes:
- Genes	11
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 87 sites [see more]

Member of regulog collections

By taxonomy - Thermococcales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 5.1 Sequence: TATAGTATCATGAAGTTAATAAA Locus tag: PH0284 Name: PF1931 Funciton: RecA-superfamily ATPase Locus tag: PH0283 Name: PF1932 Funciton: Conserved hypothetical protein
	PH0284	PF1931	RecA-superfamily ATPase
	PH0283	PF1932	Conserved hypothetical protein
Position: -18 Score: 5.3 Sequence: TTTAGTTACCTTAGGTAAATGAT Locus tag: PHS059 Name: PF0239 Funciton: Conserved hypothetical protein
	PHS059	PF0239	Conserved hypothetical protein
Position: -39 Score: 6.1 Sequence: TTTAAATACATTTAGTTATTAAA Locus tag: PH1122 Name: PF1042 Funciton: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
	PH1122	PF1042	Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
Position: -90 Score: 5.5 Sequence: TTTATTAACCTTTCTTTACTAAA Position: -47 Score: 5 Sequence: TTTAAATTCCAAGGGAGAGTAAA Locus tag: PH0600 Name: impD Funciton: Inosine monophosphate dehydrogenase
	PH0600	impD	Inosine monophosphate dehydrogenase
Position: -38 Score: 5.9 Sequence: TTTAATTACTAAATGGAAATAAA Locus tag: PH1804 Name: tip49 Funciton: TBP-interacting protein TIP49
	PH1804	tip49	TBP-interacting protein TIP49
Position: -24 Score: 6.2 Sequence: TTTAGTAACTAATGGTAACCAAA Locus tag: PH1842 Name: hsp20 Funciton: Small heat shock protein 20
	PH1842	hsp20	Small heat shock protein 20
Position: -30 Score: 6.2 Sequence: TTTAGTAACCATTAGTAAAAAAA Locus tag: PH1840 Name: vat Funciton: ATPase, AAA+ family
	PH1840	vat	ATPase, AAA+ family
Position: -14 Score: 6.3 Sequence: TTTAATAACAATAGGTGATTAAA Locus tag: PH1314 Name: PF1488 Funciton: Conserved hypothetical protein Locus tag: PH1315 Name: PF1489 Funciton: Conserved hypothetical protein
	PH1314	PF1488	Conserved hypothetical protein
	PH1315	PF1489	Conserved hypothetical protein
Position: -38 Score: 5.6 Sequence: TTTAGTTAATTTTGGTAAGAAAA Locus tag: PH1004 Name: PF1291 Funciton: Putative metallophosphoesterase
	PH1004	PF1291	Putative metallophosphoesterase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Phr in Pyrococcus horikoshii OT3

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --