Regulon of Phr in Thermococcus gammatolerans EJ3

Properties
Regulator type:	Transcription factor
TF locus tag:	TGAM_0854
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Thermococcales
Statistics of regulated genes:
- Genes	17
- Operons	13
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 87 sites [see more]

Member of regulog collections

By taxonomy - Thermococcales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 5.5 Sequence: TTTTCTAACATTAAGTTAGTAAG Locus tag: TGAM_0854 Name: phr Funciton: Heat shock response regulator Phr, ArsR family
	TGAM_0854	phr	Heat shock response regulator Phr, ArsR family
Position: -25 Score: 6.1 Sequence: TTTAAATACAAAAGGTAACTAAA Locus tag: TGAM_1373 Name: pfdA Funciton: Prefoldin, alpha subunit Locus tag: TGAM_1374 Name: pfdB Funciton: Prefoldin, beta subunit
	TGAM_1373	pfdA	Prefoldin, alpha subunit
	TGAM_1374	pfdB	Prefoldin, beta subunit
Position: -36 Score: 5 Sequence: AATGGTAACTAAAAGTTACTAAA Locus tag: TGAM_0280 Name: PF1931 Funciton: RecA-superfamily ATPase Locus tag: TGAM_0281 Name: PF1932 Funciton: Conserved hypothetical protein
	TGAM_0280	PF1931	RecA-superfamily ATPase
	TGAM_0281	PF1932	Conserved hypothetical protein
Position: -72 Score: 6.1 Sequence: TTTAGTTACCTTTTGTATTTAAA Locus tag: TGAM_1372 Name: PF1050 Funciton: Conserved hypothetical protein
	TGAM_1372	PF1050	Conserved hypothetical protein
Position: -42 Score: 4.6 Sequence: TTTAGTAACAATTCTTTAGGATA Locus tag: TGAM_0090 Name: PF0239 Funciton: Conserved hypothetical protein
	TGAM_0090	PF0239	Conserved hypothetical protein
Position: -43 Score: 5.9 Sequence: TTTAATAACCTTTTGGAAATAAA Locus tag: TGAM_0133 Name: PF0015 Funciton: Predicted chaperone Locus tag: TGAM_0132 Name: PF0014 Funciton: Conserved hypothetical protein
	TGAM_0133	PF0015	Predicted chaperone
	TGAM_0132	PF0014	Conserved hypothetical protein
Position: -55 Score: 5.6 Sequence: TTTATATACTCTGGGTTACTAAA Locus tag: TGAM_0933 Name: PF0624 Funciton: Conserved hypothetical protein
	TGAM_0933	PF0624	Conserved hypothetical protein
Position: -89 Score: 5.6 Sequence: TTTATTAACCTGAGTTAACTAAA Locus tag: TGAM_0730 Name: impD Funciton: Inosine monophosphate dehydrogenase
	TGAM_0730	impD	Inosine monophosphate dehydrogenase
Position: -48 Score: 4.8 Sequence: TTTAGTTACCTTTGGATAGATTA Locus tag: TGAM_1545 Name: tip49 Funciton: TBP-interacting protein TIP49
	TGAM_1545	tip49	TBP-interacting protein TIP49
Position: -99 Score: 5 Sequence: TTTAGTCACCTTTTGTATGGTAA Position: -50 Score: 5.9 Sequence: TTTAGTAACTACTGGTAACCAAA Locus tag: TGAM_1688 Name: hsp20 Funciton: Small heat shock protein 20 Locus tag: TGAM_1689 Name: vat Funciton: ATPase, AAA+ family
	TGAM_1688	hsp20	Small heat shock protein 20
	TGAM_1689	vat	ATPase, AAA+ family
Position: -23 Score: 6 Sequence: TTTAATAACAAAAGGTGATCAAA Locus tag: TGAM_0505 Name: PF1488 Funciton: Conserved hypothetical protein
	TGAM_0505	PF1488	Conserved hypothetical protein
Position: -38 Score: 5.8 Sequence: TTTAGTTTCTTTAGGTAAGAAAA Locus tag: TGAM_1955 Name: PF1291 Funciton: Putative metallophosphoesterase
	TGAM_1955	PF1291	Putative metallophosphoesterase
Position: -33 Score: 6 Sequence: TTTAAGAACAAAAAGTAACTAAA Locus tag: TGAM_1491 Name: PF1042 Funciton: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
	TGAM_1491	PF1042	Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Phr in Thermococcus gammatolerans EJ3

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --