Regulon of Phr in Thermococcus onnurineus NA1

Properties
Regulator type:	Transcription factor
TF locus tag:	TON_1231
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Thermococcales
Statistics of regulated genes:
- Genes	11
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 87 sites [see more]

Member of regulog collections

By taxonomy - Thermococcales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -164 Score: 5.2 Sequence: GATAATTACTTTATGTTACTAAA Locus tag: TON_0320 Name: cas2 Funciton: CRISPR-associated protein Cas2
	TON_0320	cas2	CRISPR-associated protein Cas2
Position: -37 Score: 5.6 Sequence: ATTGGTAACAAAAGGTAACTAAA Locus tag: TON_1740 Name: PF1931 Funciton: RecA-superfamily ATPase Locus tag: TON_1741 Name: PF1932 Funciton: Conserved hypothetical protein
	TON_1740	PF1931	RecA-superfamily ATPase
	TON_1741	PF1932	Conserved hypothetical protein
Position: -35 Score: 5.3 Sequence: TTTAGTAACAATTCTTTAGAAAA Locus tag: TON_1528 Name: PF0239 Funciton: Conserved hypothetical protein
	TON_1528	PF0239	Conserved hypothetical protein
Position: -42 Score: 6.1 Sequence: TTTAATAACCTTTAGAAACTAAA Locus tag: TON_1650 Name: PF0015 Funciton: Predicted chaperone Locus tag: TON_1649 Name: PF0014 Funciton: Conserved hypothetical protein
	TON_1650	PF0015	Predicted chaperone
	TON_1649	PF0014	Conserved hypothetical protein
Position: -41 Score: 5.2 Sequence: TTTTCTTACATTAAGTTAGGGAA Locus tag: TON_1231 Name: phr Funciton: Heat shock response regulator Phr, ArsR family
	TON_1231	phr	Heat shock response regulator Phr, ArsR family
Position: -95 Score: 5.5 Sequence: TTTATTAACCTAACTTAACTAAA Locus tag: TON_0361 Name: impD Funciton: Inosine monophosphate dehydrogenase
	TON_0361	impD	Inosine monophosphate dehydrogenase
Position: -41 Score: 5.9 Sequence: TTTAGTTACTACTGGTAACCAAA Locus tag: TON_1113 Name: hsp20 Funciton: Small heat shock protein 20 Locus tag: TON_1114 Name: vat Funciton: ATPase, AAA+ family
	TON_1113	hsp20	Small heat shock protein 20
	TON_1114	vat	ATPase, AAA+ family
Position: -36 Score: 5.3 Sequence: TTTAGTTAATTTGAGTAAGAAAA Locus tag: TON_0117 Name: PF1291 Funciton: Putative metallophosphoesterase
	TON_0117	PF1291	Putative metallophosphoesterase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD