Regulon of Phr in Thermococcus sibiricus MM 739

Properties
Regulator type:	Transcription factor
TF locus tag:	TSIB_1608
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Thermococcales
Statistics of regulated genes:
- Genes	13
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 87 sites [see more]

Member of regulog collections

By taxonomy - Thermococcales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -120 Score: 4.9 Sequence: TTTCAAAACCAAAAGTTAAAAAC Locus tag: TSIB_1494 Name: cas2 Funciton: CRISPR-associated protein Cas2
	TSIB_1494	cas2	CRISPR-associated protein Cas2
Position: -83 Score: 5.4 Sequence: TATACTACCAATTGGTAATTAAA Locus tag: TSIB_1804 Name: PF1931 Funciton: RecA-superfamily ATPase Locus tag: TSIB_1803 Name: PF1932 Funciton: Conserved hypothetical protein
	TSIB_1804	PF1931	RecA-superfamily ATPase
	TSIB_1803	PF1932	Conserved hypothetical protein
Position: -172 Score: 5 Sequence: TTTGTACACTTTTGGTTACTAAC Position: -158 Score: 4.6 Sequence: GTTACTAACTTTGGGTTTATAAC Locus tag: TSIB_1463 Name: PF1050 Funciton: Conserved hypothetical protein
	TSIB_1463	PF1050	Conserved hypothetical protein
Position: -23 Score: 5.4 Sequence: TTTAGTTACTGATTCTTATTAAA Locus tag: TSIB_0908 Name: PF0239 Funciton: Conserved hypothetical protein
	TSIB_0908	PF0239	Conserved hypothetical protein
Position: -41 Score: 5.9 Sequence: TTTAATAACCTATAATTACTAAA Locus tag: TSIB_1989 Name: PF0015 Funciton: Predicted chaperone Locus tag: TSIB_1990 Name: PF0014 Funciton: Conserved hypothetical protein
	TSIB_1989	PF0015	Predicted chaperone
	TSIB_1990	PF0014	Conserved hypothetical protein
Position: -48 Score: 5 Sequence: TTTATTTACATTAGGTTAGATTA Locus tag: TSIB_1608 Name: phr Funciton: Heat shock response regulator Phr, ArsR family
	TSIB_1608	phr	Heat shock response regulator Phr, ArsR family
Position: -62 Score: 6 Sequence: TTTATATACTTATTGTAACTAAA Locus tag: TSIB_0871 Name: PF0624 Funciton: Conserved hypothetical protein
	TSIB_0871	PF0624	Conserved hypothetical protein
Position: -45 Score: 5.9 Sequence: TTTAAATACCAATAGTTTCTAAA Locus tag: TSIB_1591 Name: tip49 Funciton: TBP-interacting protein TIP49
	TSIB_1591	tip49	TBP-interacting protein TIP49
Position: -11 Score: 6.3 Sequence: TTTAATAACTATTGGTAACCAAA Locus tag: TSIB_0520 Name: hsp20 Funciton: Small heat shock protein 20 Locus tag: TSIB_0521 Name: vat Funciton: ATPase, AAA+ family
	TSIB_0520	hsp20	Small heat shock protein 20
	TSIB_0521	vat	ATPase, AAA+ family
Position: -85 Score: 6.3 Sequence: TTTATTAACTTAATGTAAATAAA Locus tag: TSIB_1314 Name: impD Funciton: Inosine monophosphate dehydrogenase
	TSIB_1314	impD	Inosine monophosphate dehydrogenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Phr in Thermococcus sibiricus MM 739

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --