Regulon of Phr in Pyrococcus furiosus DSM 3638

Properties
Regulator type:	Transcription factor
TF locus tag:	PF1790
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Thermococcales
Statistics of regulated genes:
- Genes	17
- Operons	14
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 87 sites [see more]

Member of regulog collections

By taxonomy - Thermococcales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -164 Score: 4.7 Sequence: TTTCGTAACAAGTAAATAGTAAA Position: -125 Score: 5 Sequence: AATACTAACTTTGAGTTACTAAA Locus tag: PF1117 Name: cas2 Funciton: CRISPR-associated protein Cas2
	PF1117	cas2	CRISPR-associated protein Cas2
Position: -54 Score: 4.6 Sequence: TATAGTATATTGAAGTTAGTAAA Locus tag: PF1931 Name: PF1931 Funciton: RecA-superfamily ATPase Locus tag: PF1932 Name: PF1932 Funciton: Conserved hypothetical protein
	PF1931	PF1931	RecA-superfamily ATPase
	PF1932	PF1932	Conserved hypothetical protein
Position: -18 Score: 5.2 Sequence: TTTAGTTACCTATTGTAAATGAT Locus tag: PF0239 Name: PF0239 Funciton: Conserved hypothetical protein
	PF0239	PF0239	Conserved hypothetical protein
Position: -38 Score: 5.8 Sequence: TTTAAGCACTAAAAGTTATTAAA Locus tag: PF1042 Name: PF1042 Funciton: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
	PF1042	PF1042	Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
Position: -45 Score: 6 Sequence: TTTATATACTTTTTGTTACTAAA Locus tag: PF0624 Name: PF0624 Funciton: Conserved hypothetical protein
	PF0624	PF0624	Conserved hypothetical protein
Position: -93 Score: 6 Sequence: TTTATTAACCAAAGTTTACTAAA Locus tag: PF0321 Name: impD Funciton: Inosine monophosphate dehydrogenase
	PF0321	impD	Inosine monophosphate dehydrogenase
Position: -44 Score: 6 Sequence: TTTACTTACAATATGTTAGAAAA Locus tag: PF1790 Name: phr Funciton: Heat shock response regulator Phr, ArsR family
	PF1790	phr	Heat shock response regulator Phr, ArsR family
Position: -42 Score: 5.7 Sequence: TTTAATAACAAAATGGAACAAAA Locus tag: PF1847 Name: tip49 Funciton: TBP-interacting protein TIP49
	PF1847	tip49	TBP-interacting protein TIP49
Position: -41 Score: 6.3 Sequence: TTTAGTAACCATTGGTAATCAAA Locus tag: PF1882 Name: vat Funciton: ATPase, AAA+ family
	PF1882	vat	ATPase, AAA+ family
Position: -43 Score: 6.3 Sequence: TTTAATAACTAATGGTAACCAAA Locus tag: PF1883 Name: hsp20 Funciton: Small heat shock protein 20
	PF1883	hsp20	Small heat shock protein 20
Position: -119 Score: 5.2 Sequence: TTTATAAACCAAAGTTACTTAAA Position: -66 Score: 5 Sequence: TTTTGTCTATAAAAGTTAATAAA Locus tag: PF1616 Name: inoS Funciton: Inositol-1-phosphate synthase (EC 5.5.1.4)
	PF1616	inoS	Inositol-1-phosphate synthase (EC 5.5.1.4)
Position: -59 Score: 5 Sequence: TTTTCTCACCAAATGATTTAAAA Position: -25 Score: 5.9 Sequence: TTTAATAACAAATGGTGAAGAAA Locus tag: PF1488 Name: PF1488 Funciton: Conserved hypothetical protein Locus tag: PF1489 Name: PF1489 Funciton: Conserved hypothetical protein
	PF1488	PF1488	Conserved hypothetical protein
	PF1489	PF1489	Conserved hypothetical protein
Position: -41 Score: 6 Sequence: TTTAATAACCTTTTGGAACTAAA Locus tag: PF0015 Name: PF0015 Funciton: Predicted chaperone Locus tag: PF0014 Name: PF0014 Funciton: Conserved hypothetical protein
	PF0015	PF0015	Predicted chaperone
	PF0014	PF0014	Conserved hypothetical protein
Position: -39 Score: 5.6 Sequence: TTTAGTTAATTTTGGTAAGAAAA Locus tag: PF1291 Name: PF1291 Funciton: Putative metallophosphoesterase
	PF1291	PF1291	Putative metallophosphoesterase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Phr in Pyrococcus furiosus DSM 3638

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --