Regulon of Phr in Thermococcus kodakaraensis KOD1

Properties
Regulator type:	Transcription factor
TF locus tag:	TK2291
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Thermococcales
Statistics of regulated genes:
- Genes	16
- Operons	14
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 87 sites [see more]

Member of regulog collections

By taxonomy - Thermococcales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 5.2 Sequence: TTTAAATACCAAAAGTTATTTTA Position: -43 Score: 5.1 Sequence: TATTTTAACAATGGGTAAGAAAA Locus tag: TK1121 Name: pfdA Funciton: Prefoldin, alpha subunit Locus tag: TK1122 Name: pfdB Funciton: Prefoldin, beta subunit
	TK1121	pfdA	Prefoldin, alpha subunit
	TK1122	pfdB	Prefoldin, beta subunit
Position: -157 Score: 5 Sequence: GATAGTAACCAAACGTTACTAAA Locus tag: TK0445 Name: cas2 Funciton: CRISPR-associated protein Cas2
	TK0445	cas2	CRISPR-associated protein Cas2
Position: -84 Score: 5.1 Sequence: TTTTCTTACCCATTGTTAAAATA Position: -68 Score: 5.2 Sequence: TAAAATAACTTTTGGTATTTAAA Locus tag: TK1120 Name: PF1050 Funciton: Conserved hypothetical protein
	TK1120	PF1050	Conserved hypothetical protein
Position: -45 Score: 5.9 Sequence: TTTAGTTACAATTTTTTATTAAA Locus tag: TK2131 Name: PF0239 Funciton: Conserved hypothetical protein
	TK2131	PF0239	Conserved hypothetical protein
Position: -42 Score: 6.2 Sequence: TTTAATAACCTTTGGAAACTAAA Locus tag: TK1896 Name: PF0015 Funciton: Predicted chaperone Locus tag: TK1897 Name: PF0014 Funciton: Conserved hypothetical protein
	TK1896	PF0015	Predicted chaperone
	TK1897	PF0014	Conserved hypothetical protein
Position: -56 Score: 5.9 Sequence: TTTATATACTCAAGGTTACTAAA Locus tag: TK0750 Name: PF0624 Funciton: Conserved hypothetical protein
	TK0750	PF0624	Conserved hypothetical protein
Position: -93 Score: 5.6 Sequence: TTTATTAACCTAACGTTACTTAA Locus tag: TK1186 Name: impD Funciton: Inosine monophosphate dehydrogenase
	TK1186	impD	Inosine monophosphate dehydrogenase
Position: -42 Score: 5 Sequence: TTTAGTAACCTTCGGTATTCTAA Locus tag: TK1199 Name: tip49 Funciton: TBP-interacting protein TIP49
	TK1199	tip49	TBP-interacting protein TIP49
Position: -91 Score: 4.7 Sequence: TTTGGTAACCTCACTTAAGAAAA Position: -41 Score: 5.8 Sequence: TTTAGTAACTTACGGTAACCAAA Locus tag: TK1157 Name: vat Funciton: ATPase, AAA+ family
	TK1157	vat	ATPase, AAA+ family
Position: -73 Score: 4.9 Sequence: TTTGGTAACTTTCGGAGAGAAAA Position: -32 Score: 6 Sequence: TTTAATAACAATTGGTGAGAAAA Locus tag: TK1155 Name: hsp20 Funciton: Small heat shock protein 20
	TK1155	hsp20	Small heat shock protein 20
Position: -37 Score: 5.3 Sequence: TTTACTAACTTTGGGTTAGGGAA Locus tag: TK2291 Name: phr Funciton: Heat shock response regulator Phr, ArsR family
	TK2291	phr	Heat shock response regulator Phr, ArsR family
Position: -23 Score: 5.9 Sequence: TTTACTAACCTTTGGTGATGAAA Locus tag: TK2294 Name: PF1488 Funciton: Conserved hypothetical protein
	TK2294	PF1488	Conserved hypothetical protein
Position: -38 Score: 5.4 Sequence: TTTATTTTCTTCAGGTAAGAAAA Locus tag: TK1492 Name: PF1291 Funciton: Putative metallophosphoesterase
	TK1492	PF1291	Putative metallophosphoesterase
Position: -53 Score: 6.1 Sequence: TTTAAATACAAAATGTTATTAAA Locus tag: TK1097 Name: PF1042 Funciton: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
	TK1097	PF1042	Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Phr in Thermococcus kodakaraensis KOD1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --