Regulog SoxR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Genome | Genes | Operons |
|---|---|---|
| Vibrio cholerae O1 biovar eltor str. N16961 | 2 | 2 |
| Vibrio vulnificus CMCP6 | 5 | 4 |
| Vibrio harveyi ATCC BAA-1116 | 4 | 4 |
| Vibrio parahaemolyticus RIMD 2210633 | 5 | 5 |
| Vibrio shilonii AK1 | 3 | 3 |
| Vibrio splendidus LGP32 | 1 | 1 |
| Vibrio fischeri ES114 | ||
| Vibrio salmonicida LFI1238 | ||
| Vibrio angustum S14 | 3 | 3 |
| Photobacterium profundum SS9 | 2 | 2 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| PF00903 |
|
*2
Vibrio vulnificus CMCP6 Gene: VV20606: Glyoxalase/bleomycin resistance protein/dioxygenase Site: position = -58 score = 6.80665 sequence = ACCTCAATTTAACTTGAGGT Gene: VV20607: Glyoxalase/bleomycin resistance protein/dioxygenase |
*2
Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06892: Glyoxalase/bleomycin resistance protein/dioxygenase Site: position = -67 score = 6.56793 sequence = ACCTTAACTTAACTTGAGGT Gene: VIBHAR_04755: Glyoxalase/bleomycin resistance protein/dioxygenase |
*3
Vibrio parahaemolyticus RIMD 2210633 Site: position = -67 score = 6.3741 sequence = ACCTCGATTTAACTTGAGGT Gene: VPA1685: Glyoxalase/bleomycin resistance protein/dioxygenase Gene: VPA0104: Glyoxalase/bleomycin resistance protein/dioxygenase Site: position = -69 score = 6.51383 sequence = ACCTAAACTTAGCTTGAGGT Gene: VPA0391: Glyoxalase/bleomycin resistance protein/dioxygenase |
*
Vibrio shilonii AK1 Site: position = -60 score = 6.68062 sequence = ACCTCAAGTTAACTTGAGGA Gene: VSAK1_17857: Glyoxalase/bleomycin resistance protein/dioxygenase |
*
Vibrio splendidus LGP32 Site: position = -28 score = 6.97326 sequence = ACCTCAACTTAACTTGAGGT Gene: VS_II1117: Glyoxalase/bleomycin resistance protein/dioxygenase |
|
|
*
Vibrio angustum S14 Site: position = -60 score = 5.90098 sequence = ACCTCAAGTTTACTCGAGGA Gene: VAS14_15449: Glyoxalase/bleomycin resistance protein/dioxygenase |
|
Glyoxalase/bleomycin resistance protein/dioxygenase |
| CRON 2. | |||||||||||
| PF07690 |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -60 score = 6.86171 sequence = ACCTAAAGTTAACTTGAGGT Gene: VCA0085: Permease of the major facilitator superfamily |
*
Vibrio vulnificus CMCP6 Site: position = -68 score = 6.61952 sequence = ACCTCAAGTTAAGTTGAGCT Gene: VV20937: Permease of the major facilitator superfamily |
|
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -160 score = 6.75971 sequence = ACCTCAAGTTTACTTGAGGT Gene: VPA0333: Permease of the major facilitator superfamily |
*
Vibrio shilonii AK1 Site: position = -59 score = 6.08593 sequence = ACCTCAAGTAATGTTGAGGT Gene: VSAK1_19654: Permease of the major facilitator superfamily |
|
|
|
|
*
Photobacterium profundum SS9 Site: position = -62 score = 6.24807 sequence = ACCTCAAGTTAACCTGAGGC Gene: PBPRB1506: Permease of the major facilitator superfamily |
Permease of the major facilitator superfamily |
| CRON 3. | |||||||||||
| wrbA |
|
*
Vibrio vulnificus CMCP6 Site: position = -80 score = 6.68062 sequence = ACCTCAAGTTAACTTGAGGA Gene: VV21129: Multimeric flavodoxin |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -152 score = 6.54456 sequence = ACCTCAACCTAGCTTGAGGT Gene: VIBHAR_07059: Multimeric flavodoxin |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -70 score = 6.16674 sequence = ACCTAAACCAAACTTGAGGT Gene: VPA1738: Multimeric flavodoxin |
Gene: VSAK1_13932: Multimeric flavodoxin |
|
|
|
*
Vibrio angustum S14 Site: position = -63 score = 6.67424 sequence = ACCTCAGGTTAACTTGAGGT Gene: VAS14_10824: Multimeric flavodoxin |
|
Multimeric flavodoxin |
| CRON 4. | |||||||||||
| nhoA |
|
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -64 score = 6.20586 sequence = ACCTCAACTTCGGTTGAGGT Gene: VIBHAR_06924: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118) |
Gene: VPA0072: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118) |
Gene: VSAK1_14037: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118) |
|
|
|
*
Vibrio angustum S14 Site: position = -89 score = 6.41219 sequence = ACCTCAACTTAACTTGAGGG Gene: VAS14_11599: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118) |
|
N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118) |
| CRON 5. | |||||||||||
| soxR |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -138 score = 6.86171 sequence = ACCTCAAGTTAACTTTAGGT Gene: VCA0084: Redox-sensitive transcriptional activator, MerR family |
*
Vibrio vulnificus CMCP6 Site: position = -80 score = 6.61952 sequence = AGCTCAACTTAACTTGAGGT Gene: VV20936: Redox-sensitive transcriptional activator, MerR family |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -48 score = 6.26111 sequence = ACCTCAAGTGAACTTGAGGA Gene: VIBHAR_06555: Redox-sensitive transcriptional activator, MerR family |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -60 score = 6.75971 sequence = ACCTCAAGTAAACTTGAGGT Gene: VPA0335: Redox-sensitive transcriptional activator, MerR family |
*
Vibrio shilonii AK1 Site: position = -52 score = 6.08593 sequence = ACCTCAACATTACTTGAGGT Gene: VSAK1_19649: Redox-sensitive transcriptional activator, MerR family |
Gene: VS_2133: Redox-sensitive transcriptional activator, MerR family |
|
Gene: VSAL_II0225: Redox-sensitive transcriptional activator, MerR family |
Gene: VAS14_15499: Redox-sensitive transcriptional activator, MerR family |
*
Photobacterium profundum SS9 Site: position = -46 score = 6.24807 sequence = GCCTCAGGTTAACTTGAGGT Gene: PBPRB1505: Redox-sensitive transcriptional activator, MerR family |
Redox-sensitive transcriptional activator, MerR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |