Regulon of SoxR in Vibrio cholerae O1 biovar eltor str. N16961

Properties
Regulator type:	Transcription factor
TF locus tag:	VCA0084
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Vibrionales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -138 Score: 6.9 Sequence: ACCTCAAGTTAACTTTAGGT Locus tag: VCA0084 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	VCA0084	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -60 Score: 6.9 Sequence: ACCTAAAGTTAACTTGAGGT Locus tag: VCA0085 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	VCA0085	PF07690	Permease of the major facilitator superfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD