Regulon of SoxR in Vibrio angustum S14

Properties
Regulator type:	Transcription factor
TF locus tag:	VAS14_15499
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Vibrionales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 5.9 Sequence: ACCTCAAGTTTACTCGAGGA Locus tag: VAS14_15449 Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase
	VAS14_15449	PF00903	Glyoxalase/bleomycin resistance protein/dioxygenase
Position: -63 Score: 6.7 Sequence: ACCTCAGGTTAACTTGAGGT Locus tag: VAS14_10824 Name: wrbA Funciton: Multimeric flavodoxin
	VAS14_10824	wrbA	Multimeric flavodoxin
Position: -89 Score: 6.4 Sequence: ACCTCAACTTAACTTGAGGG Locus tag: VAS14_11599 Name: nhoA Funciton: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
	VAS14_11599	nhoA	N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD