Regulon of SoxR in Vibrio shilonii AK1

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAK1_19649
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Vibrionales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 6.1 Sequence: ACCTCAACATTACTTGAGGT Locus tag: VSAK1_19649 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	VSAK1_19649	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -60 Score: 6.7 Sequence: ACCTCAAGTTAACTTGAGGA Locus tag: VSAK1_17857 Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase
	VSAK1_17857	PF00903	Glyoxalase/bleomycin resistance protein/dioxygenase
Position: -59 Score: 6.1 Sequence: ACCTCAAGTAATGTTGAGGT Locus tag: VSAK1_19654 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	VSAK1_19654	PF07690	Permease of the major facilitator superfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD