Regulon of SoxR in Vibrio parahaemolyticus RIMD 2210633

Properties
Regulator type:	Transcription factor
TF locus tag:	VPA0335
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Vibrionales
Statistics of regulated genes:
- Genes	5
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 6.8 Sequence: ACCTCAAGTAAACTTGAGGT Locus tag: VPA0335 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	VPA0335	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -160 Score: 6.8 Sequence: ACCTCAAGTTTACTTGAGGT Locus tag: VPA0333 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	VPA0333	PF07690	Permease of the major facilitator superfamily
Position: -69 Score: 6.5 Sequence: ACCTAAACTTAGCTTGAGGT Locus tag: VPA0391 Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase
	VPA0391	PF00903	Glyoxalase/bleomycin resistance protein/dioxygenase
Position: -67 Score: 6.4 Sequence: ACCTCGATTTAACTTGAGGT Locus tag: VPA1685 Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase
	VPA1685	PF00903	Glyoxalase/bleomycin resistance protein/dioxygenase
Position: -70 Score: 6.2 Sequence: ACCTAAACCAAACTTGAGGT Locus tag: VPA1738 Name: wrbA Funciton: Multimeric flavodoxin
	VPA1738	wrbA	Multimeric flavodoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD