Regulon of SoxR in Vibrio vulnificus CMCP6

Properties
Regulator type:	Transcription factor
TF locus tag:	VV20936
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Vibrionales
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -80 Score: 6.6 Sequence: AGCTCAACTTAACTTGAGGT Locus tag: VV20936 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	VV20936	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -68 Score: 6.6 Sequence: ACCTCAAGTTAAGTTGAGCT Locus tag: VV20937 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	VV20937	PF07690	Permease of the major facilitator superfamily
Position: -58 Score: 6.8 Sequence: ACCTCAATTTAACTTGAGGT Locus tag: VV20607 Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase Locus tag: VV20606 Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase
	VV20607	PF00903	Glyoxalase/bleomycin resistance protein/dioxygenase
	VV20606	PF00903	Glyoxalase/bleomycin resistance protein/dioxygenase
Position: -80 Score: 6.7 Sequence: ACCTCAAGTTAACTTGAGGA Locus tag: VV21129 Name: wrbA Funciton: Multimeric flavodoxin
	VV21129	wrbA	Multimeric flavodoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD