Regulog CelR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | BglG |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - BglG
- By effector - CelB, cellobiose-specific PTS component EIIB
- By effector - HPr, phosphocarrier protein
- By pathway - Cellobiose utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | ||
| Lactococcus lactis subsp. lactis Il1403 | ||
| Streptococcus agalactiae 2603V/R | ||
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | 5 | 1 |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | 5 | 1 |
| Streptococcus gallolyticus UCN34 | 6 | 2 |
| Streptococcus gordonii str. Challis substr. CH1 | 6 | 2 |
| Streptococcus mitis B6 | ||
| Streptococcus mutans UA159 | 5 | 1 |
| Streptococcus pneumoniae TIGR4 | 7 | 2 |
| Streptococcus pyogenes M1 GAS | 6 | 2 |
| Streptococcus sanguinis SK36 | ||
| Streptococcus suis 05ZYH33 | 9 | 2 |
| Streptococcus thermophilus CNRZ1066 | ||
| Streptococcus uberis 0140J | 5 | 1 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| celF |
|
|
|
|
|
|
|
|
|
|
|
|
*
Streptococcus suis 05ZYH33 Site: position = -270 score = 6.00986 sequence = TTTCCGTTGTGATACGGAAA Gene: SSU05_2079: Alpha-galactosidase/6-phospho-beta- glucosidase |
|
|
Alpha-galactosidase/6-phospho-beta- glucosidase |
| bglA |
|
|
|
Gene: SDEG_1407: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
|
*
Streptococcus gallolyticus UCN34 Site: position = -87 score = 5.44486 sequence = TTTCCTAATAACTTAGGAAA Gene: GALLO_1217: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -89 score = 5.92426 sequence = TTTCCGTTTCGATATGGAAA Gene: SGO_1582: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
|
Gene: SMU.1601: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
*
Streptococcus pneumoniae TIGR4 Site: position = -86 score = 6.16716 sequence = TTTCCTTAACAATAAGGAAA Gene: SP_0303: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
*
Streptococcus pyogenes M1 GAS Site: position = -102 score = 5.78498 sequence = TTTCCGTGATGATAAGGAAA Gene: SPy1328: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
|
3
Streptococcus suis 05ZYH33 Gene: SSU05_0184: 6-phospho-beta-glucosidase (EC 3.2.1.86) Gene: SSU05_0185: 6-phospho-beta-glucosidase (EC 3.2.1.86) Gene: SSU05_2078: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
|
|
6-phospho-beta-glucosidase (EC 3.2.1.86) |
| celO |
|
|
|
|
Gene: Sez_1283: Predicted outer surface protein |
|
|
|
|
|
Gene: SPy1326: Predicted outer surface protein |
|
Gene: SSU05_2077: Predicted outer surface protein |
|
|
Predicted outer surface protein |
| CRON 2. | ||||||||||||||||
| celB |
|
|
|
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -83 score = 5.53688 sequence = TTGCCGTAGTGCTAAGGAAA Gene: SDEG_1401: Cellobiose-specific PTS, component EIIB |
|
*
Streptococcus gallolyticus UCN34 Site: position = -93 score = 5.92582 sequence = TTTCCTTATCAAAGAGGAAA Gene: GALLO_1213: Cellobiose-specific PTS, component EIIB |
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -96 score = 6.27651 sequence = TTTCCGTTTCGATACGGAAA Gene: SGO_1580: Cellobiose-specific PTS, component EIIB |
|
*
Streptococcus mutans UA159 Site: position = -92 score = 5.29245 sequence = TTCCGTTTTCAATACGGAAA Gene: SMU.1600: Cellobiose-specific PTS, component EIIB |
*
Streptococcus pneumoniae TIGR4 Site: position = -125 score = 5.68403 sequence = TTTCCATATCATTTAGGAAA Gene: SP_0305: Cellobiose-specific PTS, component EIIB |
|
|
|
|
*
Streptococcus uberis 0140J Site: position = -141 score = 4.8253 sequence = TTGCTTTTTTAATAGGGAAA Site: position = -100 score = 6.04989 sequence = TTTCCGCATCATTACGGAAA Gene: SUB0529: Cellobiose-specific PTS, component EIIB |
Cellobiose-specific PTS, component EIIB |
| celR |
|
|
|
Gene: SDEG_1400: Cellobiose utilization transcriptional regulator CelR, BglG family |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -97 score = 5.31342 sequence = CTTCACAATCGATACGGAAA Gene: Sez_1282: Cellobiose utilization transcriptional regulator CelR, BglG family |
Gene: GALLO_1212: Cellobiose utilization transcriptional regulator CelR, BglG family |
Gene: SGO_1579: Cellobiose utilization transcriptional regulator CelR, BglG family |
|
Gene: SMU.1599: Cellobiose utilization transcriptional regulator CelR, BglG family |
2
Streptococcus pneumoniae TIGR4 Gene: SP_0307: Cellobiose utilization transcriptional regulator CelR, BglG family Gene: SP_0306: Cellobiose utilization transcriptional regulator CelR, BglG family |
*
Streptococcus pyogenes M1 GAS Site: position = -100 score = 5.51993 sequence = TTTCACAATCAATGCGGAAA Gene: SPy1325: Cellobiose utilization transcriptional regulator CelR, BglG family |
|
*
Streptococcus suis 05ZYH33 Site: position = -100 score = 5.69953 sequence = TTTCATTAATGATGCGGAAA Gene: SSU05_2076: Cellobiose utilization transcriptional regulator CelR, BglG family |
|
Gene: SUB0530: Cellobiose utilization transcriptional regulator CelR, BglG family |
Cellobiose utilization transcriptional regulator CelR, BglG family |
| celA |
|
|
|
Gene: SDEG_1399: Cellobiose-specific PTS, component EIIA |
|
Gene: GALLO_1211: Cellobiose-specific PTS, component EIIA |
Gene: SGO_1578: Cellobiose-specific PTS, component EIIA |
|
Gene: SMU.1598: Cellobiose-specific PTS, component EIIA |
Gene: SP_0308: Cellobiose-specific PTS, component EIIA |
|
|
|
|
Gene: SUB0531: Cellobiose-specific PTS, component EIIA |
Cellobiose-specific PTS, component EIIA |
| PF06570 |
|
|
|
Gene: SDEG_1398: Hypothetical membrane protein, PF06570 family |
|
Gene: GALLO_1210: Hypothetical membrane protein, PF06570 family |
Gene: SGO_1577: Hypothetical membrane protein, PF06570 family |
|
Gene: SMU.1597c: Hypothetical membrane protein, PF06570 family |
Gene: SP_0309: Hypothetical membrane protein, PF06570 family |
|
|
|
|
Gene: SUB0532: Hypothetical membrane protein, PF06570 family |
Hypothetical membrane protein, PF06570 family |
| celD |
|
|
|
Gene: SDEG_1397: Cellobiose-specific PTS, component EIIC |
|
Gene: GALLO_1209: Cellobiose-specific PTS, component EIIC |
Gene: SGO_1576: Cellobiose-specific PTS, component EIIC |
|
Gene: SMU.1596: Cellobiose-specific PTS, component EIIC |
Gene: SP_0310: Cellobiose-specific PTS, component EIIC |
|
|
|
|
Gene: SUB0533: Cellobiose-specific PTS, component EIIC |
Cellobiose-specific PTS, component EIIC |
| celB2 |
|
|
|
|
Gene: Sez_1281: Cellobiose-specific PTS, component EIIB |
|
|
|
|
|
Gene: SPy1324: Cellobiose-specific PTS, component EIIB |
|
Gene: SSU05_2075: Cellobiose-specific PTS, component EIIB |
|
|
Cellobiose-specific PTS, component EIIB |
| celA2 |
|
|
|
|
Gene: Sez_1280: Cellobiose-specific PTS, component EIIA |
|
|
|
|
|
Gene: SPy1323: Cellobiose-specific PTS, component EIIA |
|
2
Streptococcus suis 05ZYH33 Gene: SSU05_2074: Cellobiose-specific PTS, component EIIA Gene: SSU05_2073: Cellobiose-specific PTS, component EIIA |
|
|
Cellobiose-specific PTS, component EIIA |
| PF11687 |
|
|
|
|
Gene: Sez_1279: Hypothetical membrane protein, PF11687 family |
|
|
|
|
|
Gene: SPy1322: Hypothetical membrane protein, PF11687 family |
|
Gene: SSU05_2072: Hypothetical membrane protein, PF11687 family |
|
|
Hypothetical membrane protein, PF11687 family |
| celD2 |
|
|
|
|
Gene: Sez_1278: Cellobiose-specific PTS, component EIIC |
|
|
|
|
|
|
|
Gene: SSU05_2071: Cellobiose-specific PTS, component EIIC |
|
|
Cellobiose-specific PTS, component EIIC |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |