Regulog CelR - Streptococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - BglG
By effector - CelB, cellobiose-specific PTS component EIIB
By effector - HPr, phosphocarrier protein
By pathway - Cellobiose utilization

Statistics of regulated genes
Genome	Genes	Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124	5	1
Streptococcus equi subsp. zooepidemicus MGCS10565	5	1
Streptococcus gallolyticus UCN34	6	2
Streptococcus gordonii str. Challis substr. CH1	6	2
Streptococcus mitis B6
Streptococcus mutans UA159	5	1
Streptococcus pneumoniae TIGR4	7	2
Streptococcus pyogenes M1 GAS	6	2
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33	9	2
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J	5	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
celF	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	* Streptococcus suis 05ZYH33 Site: position = -270 score = 6.00986 sequence = TTTCCGTTGTGATACGGAAA Gene: SSU05_2079: Alpha-galactosidase/6-phospho-beta- glucosidase	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Alpha-galactosidase/6-phospho-beta- glucosidase
bglA	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1407: 6-phospho-beta-glucosidase (EC 3.2.1.86)	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -87 score = 5.44486 sequence = TTTCCTAATAACTTAGGAAA Gene: GALLO_1217: 6-phospho-beta-glucosidase (EC 3.2.1.86)	* Streptococcus gordonii str. Challis substr. CH1 Site: position = -89 score = 5.92426 sequence = TTTCCGTTTCGATATGGAAA Gene: SGO_1582: 6-phospho-beta-glucosidase (EC 3.2.1.86)	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.1601: 6-phospho-beta-glucosidase (EC 3.2.1.86)	* Streptococcus pneumoniae TIGR4 Site: position = -86 score = 6.16716 sequence = TTTCCTTAACAATAAGGAAA Gene: SP_0303: 6-phospho-beta-glucosidase (EC 3.2.1.86)	* Streptococcus pyogenes M1 GAS Site: position = -102 score = 5.78498 sequence = TTTCCGTGATGATAAGGAAA Gene: SPy1328: 6-phospho-beta-glucosidase (EC 3.2.1.86)	Streptococcus sanguinis SK36	3 Streptococcus suis 05ZYH33 Gene: SSU05_0184: 6-phospho-beta-glucosidase (EC 3.2.1.86) Gene: SSU05_0185: 6-phospho-beta-glucosidase (EC 3.2.1.86) Gene: SSU05_2078: 6-phospho-beta-glucosidase (EC 3.2.1.86)	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	6-phospho-beta-glucosidase (EC 3.2.1.86)
celO	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1283: Predicted outer surface protein	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS Gene: SPy1326: Predicted outer surface protein	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33 Gene: SSU05_2077: Predicted outer surface protein	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted outer surface protein

CRON 2.
celB	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -83 score = 5.53688 sequence = TTGCCGTAGTGCTAAGGAAA Gene: SDEG_1401: Cellobiose-specific PTS, component EIIB	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -93 score = 5.92582 sequence = TTTCCTTATCAAAGAGGAAA Gene: GALLO_1213: Cellobiose-specific PTS, component EIIB	* Streptococcus gordonii str. Challis substr. CH1 Site: position = -96 score = 6.27651 sequence = TTTCCGTTTCGATACGGAAA Gene: SGO_1580: Cellobiose-specific PTS, component EIIB	Streptococcus mitis B6	* Streptococcus mutans UA159 Site: position = -92 score = 5.29245 sequence = TTCCGTTTTCAATACGGAAA Gene: SMU.1600: Cellobiose-specific PTS, component EIIB	* Streptococcus pneumoniae TIGR4 Site: position = -125 score = 5.68403 sequence = TTTCCATATCATTTAGGAAA Gene: SP_0305: Cellobiose-specific PTS, component EIIB	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	* Streptococcus uberis 0140J Site: position = -141 score = 4.8253 sequence = TTGCTTTTTTAATAGGGAAA Site: position = -100 score = 6.04989 sequence = TTTCCGCATCATTACGGAAA Gene: SUB0529: Cellobiose-specific PTS, component EIIB	Cellobiose-specific PTS, component EIIB
celR	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1400: Cellobiose utilization transcriptional regulator CelR, BglG family	* Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -97 score = 5.31342 sequence = CTTCACAATCGATACGGAAA Gene: Sez_1282: Cellobiose utilization transcriptional regulator CelR, BglG family	Streptococcus gallolyticus UCN34 Gene: GALLO_1212: Cellobiose utilization transcriptional regulator CelR, BglG family	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1579: Cellobiose utilization transcriptional regulator CelR, BglG family	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.1599: Cellobiose utilization transcriptional regulator CelR, BglG family	2 Streptococcus pneumoniae TIGR4 Gene: SP_0307: Cellobiose utilization transcriptional regulator CelR, BglG family Gene: SP_0306: Cellobiose utilization transcriptional regulator CelR, BglG family	* Streptococcus pyogenes M1 GAS Site: position = -100 score = 5.51993 sequence = TTTCACAATCAATGCGGAAA Gene: SPy1325: Cellobiose utilization transcriptional regulator CelR, BglG family	Streptococcus sanguinis SK36	* Streptococcus suis 05ZYH33 Site: position = -100 score = 5.69953 sequence = TTTCATTAATGATGCGGAAA Gene: SSU05_2076: Cellobiose utilization transcriptional regulator CelR, BglG family	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J Gene: SUB0530: Cellobiose utilization transcriptional regulator CelR, BglG family	Cellobiose utilization transcriptional regulator CelR, BglG family
celA	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1399: Cellobiose-specific PTS, component EIIA	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1211: Cellobiose-specific PTS, component EIIA	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1578: Cellobiose-specific PTS, component EIIA	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.1598: Cellobiose-specific PTS, component EIIA	Streptococcus pneumoniae TIGR4 Gene: SP_0308: Cellobiose-specific PTS, component EIIA	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J Gene: SUB0531: Cellobiose-specific PTS, component EIIA	Cellobiose-specific PTS, component EIIA
PF06570	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1398: Hypothetical membrane protein, PF06570 family	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1210: Hypothetical membrane protein, PF06570 family	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1577: Hypothetical membrane protein, PF06570 family	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.1597c: Hypothetical membrane protein, PF06570 family	Streptococcus pneumoniae TIGR4 Gene: SP_0309: Hypothetical membrane protein, PF06570 family	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J Gene: SUB0532: Hypothetical membrane protein, PF06570 family	Hypothetical membrane protein, PF06570 family
celD	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1397: Cellobiose-specific PTS, component EIIC	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1209: Cellobiose-specific PTS, component EIIC	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1576: Cellobiose-specific PTS, component EIIC	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.1596: Cellobiose-specific PTS, component EIIC	Streptococcus pneumoniae TIGR4 Gene: SP_0310: Cellobiose-specific PTS, component EIIC	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J Gene: SUB0533: Cellobiose-specific PTS, component EIIC	Cellobiose-specific PTS, component EIIC
celB2	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1281: Cellobiose-specific PTS, component EIIB	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS Gene: SPy1324: Cellobiose-specific PTS, component EIIB	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33 Gene: SSU05_2075: Cellobiose-specific PTS, component EIIB	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Cellobiose-specific PTS, component EIIB
celA2	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1280: Cellobiose-specific PTS, component EIIA	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS Gene: SPy1323: Cellobiose-specific PTS, component EIIA	Streptococcus sanguinis SK36	2 Streptococcus suis 05ZYH33 Gene: SSU05_2074: Cellobiose-specific PTS, component EIIA Gene: SSU05_2073: Cellobiose-specific PTS, component EIIA	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Cellobiose-specific PTS, component EIIA
PF11687	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1279: Hypothetical membrane protein, PF11687 family	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS Gene: SPy1322: Hypothetical membrane protein, PF11687 family	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33 Gene: SSU05_2072: Hypothetical membrane protein, PF11687 family	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Hypothetical membrane protein, PF11687 family
celD2	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1278: Cellobiose-specific PTS, component EIIC	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33 Gene: SSU05_2071: Cellobiose-specific PTS, component EIIC	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Cellobiose-specific PTS, component EIIC

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CelR - Streptococcaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --