Regulon of CelR in Streptococcus dysgalactiae subsp. equisimilis GGS_124
| Regulator type: | Transcription factor |
| TF locus tag: | SDEG_1400 |
| Regulator family: | BglG |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein |
| Regulog: | CelR - Streptococcaceae |
| Statistics of regulated genes: | |
| - Genes | 5 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - BglG
- By effector - CelB, cellobiose-specific PTS component EIIB
- By effector - HPr, phosphocarrier protein
- By pathway - Cellobiose utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -83
Score: 5.5 Sequence: TTGCCGTAGTGCTAAGGAAA
Locus tag: SDEG_1401
Name: celB Funciton: Cellobiose-specific PTS, component EIIB
Locus tag: SDEG_1400
Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family
Locus tag: SDEG_1399
Name: celA Funciton: Cellobiose-specific PTS, component EIIA
Locus tag: SDEG_1398
Name: PF06570 Funciton: Hypothetical membrane protein, PF06570 family
Locus tag: SDEG_1397
Name: celD Funciton: Cellobiose-specific PTS, component EIIC |
|||
|
celB
|
Cellobiose-specific PTS, component EIIB
|
||
|
celR
|
Cellobiose utilization transcriptional regulator CelR, BglG family
|
||
|
celA
|
Cellobiose-specific PTS, component EIIA
|
||
|
PF06570
|
Hypothetical membrane protein, PF06570 family
|
||
|
celD
|
Cellobiose-specific PTS, component EIIC
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |