Regulon of CelR in Streptococcus dysgalactiae subsp. equisimilis GGS_124

Properties
Regulator type:	Transcription factor
TF locus tag:	SDEG_1400
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Regulog:	CelR - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - BglG
By effector - CelB, cellobiose-specific PTS component EIIB
By effector - HPr, phosphocarrier protein
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 5.5 Sequence: TTGCCGTAGTGCTAAGGAAA Locus tag: SDEG_1401 Name: celB Funciton: Cellobiose-specific PTS, component EIIB Locus tag: SDEG_1400 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: SDEG_1399 Name: celA Funciton: Cellobiose-specific PTS, component EIIA Locus tag: SDEG_1398 Name: PF06570 Funciton: Hypothetical membrane protein, PF06570 family Locus tag: SDEG_1397 Name: celD Funciton: Cellobiose-specific PTS, component EIIC
	SDEG_1401	celB	Cellobiose-specific PTS, component EIIB
	SDEG_1400	celR	Cellobiose utilization transcriptional regulator CelR, BglG family
	SDEG_1399	celA	Cellobiose-specific PTS, component EIIA
	SDEG_1398	PF06570	Hypothetical membrane protein, PF06570 family
	SDEG_1397	celD	Cellobiose-specific PTS, component EIIC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD