Orthologous regulated operons containing celD2 gene

Properties
Regulog:	CelR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum:	Firmicutes

Built upon 15 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Streptococcus equi subsp. zooepidemicus MGCS10565
Position: -97 Score: 5.31342 Sequence: CTTCACAATCGATACGGAAA Locus tag: Sez_1282 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: Sez_1281 Name: celB2 Funciton: Cellobiose-specific PTS, component EIIB Locus tag: Sez_1280 Name: celA2 Funciton: Cellobiose-specific PTS, component EIIA Locus tag: Sez_1279 Name: PF11687 Funciton: Hypothetical membrane protein, PF11687 family Locus tag: Sez_1278 Name: celD2 Funciton: Cellobiose-specific PTS, component EIIC
celR-celB2-celA2-PF11687-celD2	-97	5.3	CTTCACAATCGATACGGAAA	Sez_1282
Streptococcus suis 05ZYH33
Position: -100 Score: 5.69953 Sequence: TTTCATTAATGATGCGGAAA Locus tag: SSU05_2076 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: SSU05_2075 Name: celB2 Funciton: Cellobiose-specific PTS, component EIIB Locus tag: SSU05_2074 Name: celA2 Funciton: Cellobiose-specific PTS, component EIIA Locus tag: SSU05_2073 Name: celA2 Funciton: Cellobiose-specific PTS, component EIIA Locus tag: SSU05_2072 Name: PF11687 Funciton: Hypothetical membrane protein, PF11687 family Locus tag: SSU05_2071 Name: celD2 Funciton: Cellobiose-specific PTS, component EIIC
celR-celB2-celA2-celA2-PF11687-celD2	-100	5.7	TTTCATTAATGATGCGGAAA	SSU05_2076

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --