Regulon of CelR in Streptococcus gallolyticus UCN34

Properties
Regulator type:	Transcription factor
TF locus tag:	GALLO_1212
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Regulog:	CelR - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - BglG
By effector - CelB, cellobiose-specific PTS component EIIB
By effector - HPr, phosphocarrier protein
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 5.4 Sequence: TTTCCTAATAACTTAGGAAA Locus tag: GALLO_1217 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
	GALLO_1217	bglA	6-phospho-beta-glucosidase (EC 3.2.1.86)
Position: -93 Score: 5.9 Sequence: TTTCCTTATCAAAGAGGAAA Locus tag: GALLO_1213 Name: celB Funciton: Cellobiose-specific PTS, component EIIB Locus tag: GALLO_1212 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: GALLO_1211 Name: celA Funciton: Cellobiose-specific PTS, component EIIA Locus tag: GALLO_1210 Name: PF06570 Funciton: Hypothetical membrane protein, PF06570 family Locus tag: GALLO_1209 Name: celD Funciton: Cellobiose-specific PTS, component EIIC
	GALLO_1213	celB	Cellobiose-specific PTS, component EIIB
	GALLO_1212	celR	Cellobiose utilization transcriptional regulator CelR, BglG family
	GALLO_1211	celA	Cellobiose-specific PTS, component EIIA
	GALLO_1210	PF06570	Hypothetical membrane protein, PF06570 family
	GALLO_1209	celD	Cellobiose-specific PTS, component EIIC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD