Regulon of CelR in Streptococcus suis 05ZYH33

Properties
Regulator type:	Transcription factor
TF locus tag:	SSU05_2076
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Regulog:	CelR - Streptococcaceae
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - BglG
By effector - CelB, cellobiose-specific PTS component EIIB
By effector - HPr, phosphocarrier protein
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -270 Score: 6 Sequence: TTTCCGTTGTGATACGGAAA Locus tag: SSU05_2079 Name: celF Funciton: Alpha-galactosidase/6-phospho-beta- glucosidase Locus tag: SSU05_2078 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: SSU05_2077 Name: celO Funciton: Predicted outer surface protein
	SSU05_2079	celF	Alpha-galactosidase/6-phospho-beta- glucosidase
	SSU05_2078	bglA	6-phospho-beta-glucosidase (EC 3.2.1.86)
	SSU05_2077	celO	Predicted outer surface protein
Position: -100 Score: 5.7 Sequence: TTTCATTAATGATGCGGAAA Locus tag: SSU05_2076 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: SSU05_2075 Name: celB2 Funciton: Cellobiose-specific PTS, component EIIB Locus tag: SSU05_2074 Name: celA2 Funciton: Cellobiose-specific PTS, component EIIA Locus tag: SSU05_2073 Name: celA2 Funciton: Cellobiose-specific PTS, component EIIA Locus tag: SSU05_2072 Name: PF11687 Funciton: Hypothetical membrane protein, PF11687 family Locus tag: SSU05_2071 Name: celD2 Funciton: Cellobiose-specific PTS, component EIIC
	SSU05_2076	celR	Cellobiose utilization transcriptional regulator CelR, BglG family
	SSU05_2075	celB2	Cellobiose-specific PTS, component EIIB
	SSU05_2074	celA2	Cellobiose-specific PTS, component EIIA
	SSU05_2073	celA2	Cellobiose-specific PTS, component EIIA
	SSU05_2072	PF11687	Hypothetical membrane protein, PF11687 family
	SSU05_2071	celD2	Cellobiose-specific PTS, component EIIC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD