Regulon of CelR in Streptococcus equi subsp. zooepidemicus MGCS10565

Properties
Regulator type:	Transcription factor
TF locus tag:	Sez_1282
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Regulog:	CelR - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - BglG
By effector - CelB, cellobiose-specific PTS component EIIB
By effector - HPr, phosphocarrier protein
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -97 Score: 5.3 Sequence: CTTCACAATCGATACGGAAA Locus tag: Sez_1282 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: Sez_1281 Name: celB2 Funciton: Cellobiose-specific PTS, component EIIB Locus tag: Sez_1280 Name: celA2 Funciton: Cellobiose-specific PTS, component EIIA Locus tag: Sez_1279 Name: PF11687 Funciton: Hypothetical membrane protein, PF11687 family Locus tag: Sez_1278 Name: celD2 Funciton: Cellobiose-specific PTS, component EIIC
	Sez_1282	celR	Cellobiose utilization transcriptional regulator CelR, BglG family
	Sez_1281	celB2	Cellobiose-specific PTS, component EIIB
	Sez_1280	celA2	Cellobiose-specific PTS, component EIIA
	Sez_1279	PF11687	Hypothetical membrane protein, PF11687 family
	Sez_1278	celD2	Cellobiose-specific PTS, component EIIC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD