Regulon of CelR in Streptococcus pneumoniae TIGR4

Properties
Regulator type:	Transcription factor
TF locus tag:	SP_0306, SP_0307
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Regulog:	CelR - Streptococcaceae
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - BglG
By effector - CelB, cellobiose-specific PTS component EIIB
By effector - HPr, phosphocarrier protein
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -86 Score: 6.2 Sequence: TTTCCTTAACAATAAGGAAA Locus tag: SP_0303 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
	SP_0303	bglA	6-phospho-beta-glucosidase (EC 3.2.1.86)
Position: -125 Score: 5.7 Sequence: TTTCCATATCATTTAGGAAA Locus tag: SP_0305 Name: celB Funciton: Cellobiose-specific PTS, component EIIB Locus tag: SP_0306 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: SP_0307 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: SP_0308 Name: celA Funciton: Cellobiose-specific PTS, component EIIA Locus tag: SP_0309 Name: PF06570 Funciton: Hypothetical membrane protein, PF06570 family Locus tag: SP_0310 Name: celD Funciton: Cellobiose-specific PTS, component EIIC
	SP_0305	celB	Cellobiose-specific PTS, component EIIB
	SP_0306	celR	Cellobiose utilization transcriptional regulator CelR, BglG family
	SP_0307	celR	Cellobiose utilization transcriptional regulator CelR, BglG family
	SP_0308	celA	Cellobiose-specific PTS, component EIIA
	SP_0309	PF06570	Hypothetical membrane protein, PF06570 family
	SP_0310	celD	Cellobiose-specific PTS, component EIIC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD