Regulon of CelR in Streptococcus pyogenes M1 GAS

Properties
Regulator type:	Transcription factor
TF locus tag:	SPy1325
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Regulog:	CelR - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - BglG
By effector - CelB, cellobiose-specific PTS component EIIB
By effector - HPr, phosphocarrier protein
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -100 Score: 5.5 Sequence: TTTCACAATCAATGCGGAAA Locus tag: SPy1325 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: SPy1324 Name: celB2 Funciton: Cellobiose-specific PTS, component EIIB Locus tag: SPy1323 Name: celA2 Funciton: Cellobiose-specific PTS, component EIIA Locus tag: SPy1322 Name: PF11687 Funciton: Hypothetical membrane protein, PF11687 family
	SPy1325	celR	Cellobiose utilization transcriptional regulator CelR, BglG family
	SPy1324	celB2	Cellobiose-specific PTS, component EIIB
	SPy1323	celA2	Cellobiose-specific PTS, component EIIA
	SPy1322	PF11687	Hypothetical membrane protein, PF11687 family
Position: -102 Score: 5.8 Sequence: TTTCCGTGATGATAAGGAAA Locus tag: SPy1328 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: SPy1326 Name: celO Funciton: Predicted outer surface protein
	SPy1328	bglA	6-phospho-beta-glucosidase (EC 3.2.1.86)
	SPy1326	celO	Predicted outer surface protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD