Regulog PaaR - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Phenylacetic acid degradation |
| Effector: | Phenylacetyl-CoA |
| Phylum: | Betaproteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - PaaR
- By taxonomy - Comamonadaceae
- By TF family - TetR
- By effector - Phenylacetyl-CoA
- By pathway - Phenylacetic acid degradation
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | ||
| Acidovorax sp. JS42 | ||
| Comamonas testosteroni KF-1 | ||
| Delftia acidovorans SPH-1 | 15 | 3 |
| Leptothrix cholodnii SP-6 | 13 | 3 |
| Methylibium petroleiphilum PM1 | 10 | 2 |
| Polaromonas naphthalenivorans CJ2 | ||
| Polaromonas sp. JS666 | ||
| Rhodoferax ferrireducens DSM 15236 | ||
| Variovorax paradoxus S110 | 15 | 2 |
| Verminephrobacter eiseniae EF01-2 | 12 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| paaF |
|
|
|
*
Delftia acidovorans SPH-1 Site: position = -71 score = 5.20424 sequence = ATTTACCGACCATTCGGTAAAT Gene: Daci_0568: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Leptothrix cholodnii SP-6 Site: position = -42 score = 5.76971 sequence = ATTTACCTACCGGTCGGTCAAG Gene: Lcho_2405: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Methylibium petroleiphilum PM1 Site: position = -85 score = 5.66643 sequence = GTCTACCGACTGGTCGGTCAAT Gene: Mpe_A0984: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
|
|
*
Variovorax paradoxus S110 Site: position = -48 score = 5.49521 sequence = ATCTACCGGACGGTCGGTCAAT Site: position = -52 score = 4.62868 sequence = TAAAATCTACCGGACGGTCGGT Gene: Vapar_1238: Enoyl-CoA hydratase (EC 4.2.1.17) |
*
Verminephrobacter eiseniae EF01-2 Site: position = -102 score = 5.49521 sequence = ATCTACCGCACGGTCGGTCAAT Gene: Veis_3942: Enoyl-CoA hydratase (EC 4.2.1.17) |
Enoyl-CoA hydratase (EC 4.2.1.17) |
| paaY |
|
|
|
Gene: Daci_0569: thioesterase superfamily protein |
Gene: Lcho_2404: thioesterase superfamily protein |
Gene: Mpe_A0985: thioesterase superfamily protein |
|
|
|
Gene: Vapar_1237: thioesterase superfamily protein |
Gene: Veis_3943: thioesterase superfamily protein |
thioesterase superfamily protein |
| paaK |
|
|
|
*2
Delftia acidovorans SPH-1 Gene: Daci_0570: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Site: position = -59 score = 5.72992 sequence = TCCTACCGTCCGGTCGGTCAAT Site: position = -63 score = 4.56736 sequence = ATAATCCTACCGTCCGGTCGGT Gene: Daci_0809: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: Lcho_2403: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: Mpe_A0986: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
|
|
|
Gene: Vapar_1236: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: Veis_3944: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
| paaA |
|
|
|
Gene: Daci_0810: Phenylacetate-CoA oxygenase, PaaA subunit |
*
Leptothrix cholodnii SP-6 Site: position = -48 score = 6.29162 sequence = ATTTACCGACCGGACGGTCAAT Gene: Lcho_3574: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: Mpe_A0987: Phenylacetate-CoA oxygenase, PaaA subunit |
|
|
|
Gene: Vapar_1235: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: Veis_3945: Phenylacetate-CoA oxygenase, PaaA subunit |
Phenylacetate-CoA oxygenase, PaaA subunit |
| paaB |
|
|
|
Gene: Daci_0811: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Lcho_3573: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Mpe_A0988: Phenylacetate-CoA oxygenase, PaaB subunit |
|
|
|
Gene: Vapar_1234: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Veis_3946: Phenylacetate-CoA oxygenase, PaaB subunit |
Phenylacetate-CoA oxygenase, PaaB subunit |
| paaC |
|
|
|
Gene: Daci_0812: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Lcho_3572: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Mpe_A0989: Phenylacetate-CoA oxygenase, PaaC subunit |
|
|
|
Gene: Vapar_1233: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Veis_3947: Phenylacetate-CoA oxygenase, PaaC subunit |
Phenylacetate-CoA oxygenase, PaaC subunit |
| paaD |
|
|
|
Gene: Daci_0813: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Lcho_3571: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Mpe_A0990: Phenylacetate-CoA oxygenase, PaaD subunit |
|
|
|
Gene: Vapar_1232: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Veis_3948: Phenylacetate-CoA oxygenase, PaaD subunit |
Phenylacetate-CoA oxygenase, PaaD subunit |
| paaE |
|
|
|
Gene: Daci_0814: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Lcho_3569: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Mpe_A0991: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
|
|
|
Gene: Vapar_1231: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Veis_3949: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
| livK |
|
|
|
Gene: Daci_0572: Putative branched-chain amino acid ABC transporter, substrate-binding component |
Gene: Lcho_2401: Putative branched-chain amino acid ABC transporter, substrate-binding component |
|
|
|
|
Gene: Vapar_1230: Putative branched-chain amino acid ABC transporter, substrate-binding component |
Gene: Veis_3951: Putative branched-chain amino acid ABC transporter, substrate-binding component |
Putative branched-chain amino acid ABC transporter, substrate-binding component |
| livH |
|
|
|
Gene: Daci_0573: Putative branched-chain amino acid ABC transporter, permease component |
|
|
|
|
|
Gene: Vapar_1229: Putative branched-chain amino acid ABC transporter, permease component |
Gene: Veis_3952: Putative branched-chain amino acid ABC transporter, permease component |
Putative branched-chain amino acid ABC transporter, permease component |
| livM |
|
|
|
Gene: Daci_0574: Putative branched-chain amino acid ABC transporter, ATPase component |
|
|
|
|
|
Gene: Vapar_1228: Putative branched-chain amino acid ABC transporter, ATPase component |
Gene: Veis_3953: Putative branched-chain amino acid ABC transporter, ATPase component |
Putative branched-chain amino acid ABC transporter, ATPase component |
| livF |
|
|
|
Gene: Daci_0575: Putative branched-chain amino acid ABC transporter, permease component 2 |
|
|
|
|
|
Gene: Vapar_1227: Putative branched-chain amino acid ABC transporter, permease component 2 |
|
Putative branched-chain amino acid ABC transporter, permease component 2 |
| paaZ |
|
|
|
*
Delftia acidovorans SPH-1 Site: position = -111 score = 5.9813 sequence = ATTGACCGACCGGACGGTAGGA Gene: Daci_0808: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
Gene: Lcho_3568: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
|
|
|
|
Gene: Vapar_1226: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
|
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
| paaR |
|
|
|
2
Delftia acidovorans SPH-1 Gene: Daci_0807: Transcriptional regulator of phenylacetic acid degradation, TetR family Gene: Daci_0571: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: Lcho_2402: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: Mpe_A0992: Transcriptional regulator of phenylacetic acid degradation, TetR family |
|
|
|
Gene: Vapar_1240: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Gene: Veis_3950: Transcriptional regulator of phenylacetic acid degradation, TetR family |
Transcriptional regulator of phenylacetic acid degradation, TetR family |
| Lcho_0276 |
|
|
|
|
Gene: Lcho_3570: hypothetical protein |
|
|
|
|
|
|
hypothetical protein |
| paaY2 |
|
|
|
|
*
Leptothrix cholodnii SP-6 Site: position = -115 score = 5.54802 sequence = CTTGACCGACCGGTAGGTAAAT Gene: Lcho_2406: phenylacetic acid degradation protein PaaY |
*
Methylibium petroleiphilum PM1 Site: position = -78 score = 5.58326 sequence = ATTGACCGACCAGTCGGTAGAC Gene: Mpe_A0983: phenylacetic acid degradation protein PaaY |
|
|
|
*
Variovorax paradoxus S110 Site: position = -101 score = 5.43112 sequence = ATTGACCGACCGTCCGGTAGAT Gene: Vapar_1239: phenylacetic acid degradation protein PaaY |
|
phenylacetic acid degradation protein PaaY |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |