Regulog PaaR - Comamonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Betaproteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By taxonomy - Comamonadaceae
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Statistics of regulated genes
Genome	Genes	Operons
Acidovorax avenae subsp. citrulli AAC00-1
Acidovorax sp. JS42
Comamonas testosteroni KF-1
Delftia acidovorans SPH-1	15	3
Leptothrix cholodnii SP-6	13	3
Methylibium petroleiphilum PM1	10	2
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110	15	2
Verminephrobacter eiseniae EF01-2	12	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
paaF	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	* Delftia acidovorans SPH-1 Site: position = -71 score = 5.20424 sequence = ATTTACCGACCATTCGGTAAAT Gene: Daci_0568: Enoyl-CoA hydratase (EC 4.2.1.17)	* Leptothrix cholodnii SP-6 Site: position = -42 score = 5.76971 sequence = ATTTACCTACCGGTCGGTCAAG Gene: Lcho_2405: Enoyl-CoA hydratase (EC 4.2.1.17)	* Methylibium petroleiphilum PM1 Site: position = -85 score = 5.66643 sequence = GTCTACCGACTGGTCGGTCAAT Gene: Mpe_A0984: Enoyl-CoA hydratase (EC 4.2.1.17)	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	* Variovorax paradoxus S110 Site: position = -48 score = 5.49521 sequence = ATCTACCGGACGGTCGGTCAAT Site: position = -52 score = 4.62868 sequence = TAAAATCTACCGGACGGTCGGT Gene: Vapar_1238: Enoyl-CoA hydratase (EC 4.2.1.17)	* Verminephrobacter eiseniae EF01-2 Site: position = -102 score = 5.49521 sequence = ATCTACCGCACGGTCGGTCAAT Gene: Veis_3942: Enoyl-CoA hydratase (EC 4.2.1.17)	Enoyl-CoA hydratase (EC 4.2.1.17)
paaY	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1 Gene: Daci_0569: thioesterase superfamily protein	Leptothrix cholodnii SP-6 Gene: Lcho_2404: thioesterase superfamily protein	Methylibium petroleiphilum PM1 Gene: Mpe_A0985: thioesterase superfamily protein	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1237: thioesterase superfamily protein	Verminephrobacter eiseniae EF01-2 Gene: Veis_3943: thioesterase superfamily protein	thioesterase superfamily protein
paaK	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	2 Delftia acidovorans SPH-1* Gene: Daci_0570: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Site: position = -59 score = 5.72992 sequence = TCCTACCGTCCGGTCGGTCAAT Site: position = -63 score = 4.56736 sequence = ATAATCCTACCGTCCGGTCGGT Gene: Daci_0809: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Leptothrix cholodnii SP-6 Gene: Lcho_2403: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Methylibium petroleiphilum PM1 Gene: Mpe_A0986: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1236: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Verminephrobacter eiseniae EF01-2 Gene: Veis_3944: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaA	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1 Gene: Daci_0810: Phenylacetate-CoA oxygenase, PaaA subunit	* Leptothrix cholodnii SP-6 Site: position = -48 score = 6.29162 sequence = ATTTACCGACCGGACGGTCAAT Gene: Lcho_3574: Phenylacetate-CoA oxygenase, PaaA subunit	Methylibium petroleiphilum PM1 Gene: Mpe_A0987: Phenylacetate-CoA oxygenase, PaaA subunit	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1235: Phenylacetate-CoA oxygenase, PaaA subunit	Verminephrobacter eiseniae EF01-2 Gene: Veis_3945: Phenylacetate-CoA oxygenase, PaaA subunit	Phenylacetate-CoA oxygenase, PaaA subunit
paaB	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1 Gene: Daci_0811: Phenylacetate-CoA oxygenase, PaaB subunit	Leptothrix cholodnii SP-6 Gene: Lcho_3573: Phenylacetate-CoA oxygenase, PaaB subunit	Methylibium petroleiphilum PM1 Gene: Mpe_A0988: Phenylacetate-CoA oxygenase, PaaB subunit	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1234: Phenylacetate-CoA oxygenase, PaaB subunit	Verminephrobacter eiseniae EF01-2 Gene: Veis_3946: Phenylacetate-CoA oxygenase, PaaB subunit	Phenylacetate-CoA oxygenase, PaaB subunit
paaC	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1 Gene: Daci_0812: Phenylacetate-CoA oxygenase, PaaC subunit	Leptothrix cholodnii SP-6 Gene: Lcho_3572: Phenylacetate-CoA oxygenase, PaaC subunit	Methylibium petroleiphilum PM1 Gene: Mpe_A0989: Phenylacetate-CoA oxygenase, PaaC subunit	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1233: Phenylacetate-CoA oxygenase, PaaC subunit	Verminephrobacter eiseniae EF01-2 Gene: Veis_3947: Phenylacetate-CoA oxygenase, PaaC subunit	Phenylacetate-CoA oxygenase, PaaC subunit
paaD	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1 Gene: Daci_0813: Phenylacetate-CoA oxygenase, PaaD subunit	Leptothrix cholodnii SP-6 Gene: Lcho_3571: Phenylacetate-CoA oxygenase, PaaD subunit	Methylibium petroleiphilum PM1 Gene: Mpe_A0990: Phenylacetate-CoA oxygenase, PaaD subunit	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1232: Phenylacetate-CoA oxygenase, PaaD subunit	Verminephrobacter eiseniae EF01-2 Gene: Veis_3948: Phenylacetate-CoA oxygenase, PaaD subunit	Phenylacetate-CoA oxygenase, PaaD subunit
paaE	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1 Gene: Daci_0814: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Leptothrix cholodnii SP-6 Gene: Lcho_3569: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Methylibium petroleiphilum PM1 Gene: Mpe_A0991: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1231: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Verminephrobacter eiseniae EF01-2 Gene: Veis_3949: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
livK	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1 Gene: Daci_0572: Putative branched-chain amino acid ABC transporter, substrate-binding component	Leptothrix cholodnii SP-6 Gene: Lcho_2401: Putative branched-chain amino acid ABC transporter, substrate-binding component	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1230: Putative branched-chain amino acid ABC transporter, substrate-binding component	Verminephrobacter eiseniae EF01-2 Gene: Veis_3951: Putative branched-chain amino acid ABC transporter, substrate-binding component	Putative branched-chain amino acid ABC transporter, substrate-binding component
livH	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1 Gene: Daci_0573: Putative branched-chain amino acid ABC transporter, permease component	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1229: Putative branched-chain amino acid ABC transporter, permease component	Verminephrobacter eiseniae EF01-2 Gene: Veis_3952: Putative branched-chain amino acid ABC transporter, permease component	Putative branched-chain amino acid ABC transporter, permease component
livM	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1 Gene: Daci_0574: Putative branched-chain amino acid ABC transporter, ATPase component	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1228: Putative branched-chain amino acid ABC transporter, ATPase component	Verminephrobacter eiseniae EF01-2 Gene: Veis_3953: Putative branched-chain amino acid ABC transporter, ATPase component	Putative branched-chain amino acid ABC transporter, ATPase component
livF	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1 Gene: Daci_0575: Putative branched-chain amino acid ABC transporter, permease component 2	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1227: Putative branched-chain amino acid ABC transporter, permease component 2	Verminephrobacter eiseniae EF01-2	Putative branched-chain amino acid ABC transporter, permease component 2
paaZ	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	* Delftia acidovorans SPH-1 Site: position = -111 score = 5.9813 sequence = ATTGACCGACCGGACGGTAGGA Gene: Daci_0808: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	Leptothrix cholodnii SP-6 Gene: Lcho_3568: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1226: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ	Verminephrobacter eiseniae EF01-2	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaR	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	2 Delftia acidovorans SPH-1 Gene: Daci_0807: Transcriptional regulator of phenylacetic acid degradation, TetR family Gene: Daci_0571: Transcriptional regulator of phenylacetic acid degradation, TetR family	Leptothrix cholodnii SP-6 Gene: Lcho_2402: Transcriptional regulator of phenylacetic acid degradation, TetR family	Methylibium petroleiphilum PM1 Gene: Mpe_A0992: Transcriptional regulator of phenylacetic acid degradation, TetR family	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_1240: Transcriptional regulator of phenylacetic acid degradation, TetR family	Verminephrobacter eiseniae EF01-2 Gene: Veis_3950: Transcriptional regulator of phenylacetic acid degradation, TetR family	Transcriptional regulator of phenylacetic acid degradation, TetR family
Lcho_0276	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Leptothrix cholodnii SP-6 Gene: Lcho_3570: hypothetical protein	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	hypothetical protein
paaY2	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	* Leptothrix cholodnii SP-6 Site: position = -115 score = 5.54802 sequence = CTTGACCGACCGGTAGGTAAAT Gene: Lcho_2406: phenylacetic acid degradation protein PaaY	* Methylibium petroleiphilum PM1 Site: position = -78 score = 5.58326 sequence = ATTGACCGACCAGTCGGTAGAC Gene: Mpe_A0983: phenylacetic acid degradation protein PaaY	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	* Variovorax paradoxus S110 Site: position = -101 score = 5.43112 sequence = ATTGACCGACCGTCCGGTAGAT Gene: Vapar_1239: phenylacetic acid degradation protein PaaY	Verminephrobacter eiseniae EF01-2	phenylacetic acid degradation protein PaaY

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog PaaR - Comamonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --