Regulon of PaaR in Leptothrix cholodnii SP-6

Properties
Regulator type:	Transcription factor
TF locus tag:	Lcho_2402
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Comamonadaceae
Statistics of regulated genes:
- Genes	13
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By taxonomy - Comamonadaceae
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -115 Score: 5.5 Sequence: CTTGACCGACCGGTAGGTAAAT Locus tag: Lcho_2406 Name: paaY2 Funciton: phenylacetic acid degradation protein PaaY
	Lcho_2406	paaY2	phenylacetic acid degradation protein PaaY
Position: -42 Score: 5.8 Sequence: ATTTACCTACCGGTCGGTCAAG Locus tag: Lcho_2405 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Lcho_2404 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Lcho_2403 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: Lcho_2402 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family Locus tag: Lcho_2401 Name: livK Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component
	Lcho_2405	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	Lcho_2404	paaY	thioesterase superfamily protein
	Lcho_2403	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Lcho_2402	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
	Lcho_2401	livK	Putative branched-chain amino acid ABC transporter, substrate-binding component
Position: -48 Score: 6.3 Sequence: ATTTACCGACCGGACGGTCAAT Locus tag: Lcho_3574 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Lcho_3573 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Lcho_3572 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Lcho_3571 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Lcho_3570 Name: null Funciton: hypothetical protein Locus tag: Lcho_3569 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Lcho_3568 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	Lcho_3574	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Lcho_3573	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Lcho_3572	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Lcho_3571	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Lcho_3570		hypothetical protein
	Lcho_3569	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Lcho_3568	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD