Regulon of PaaR in Methylibium petroleiphilum PM1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mpe_A0992
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Comamonadaceae
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By taxonomy - Comamonadaceae
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 5.7 Sequence: GTCTACCGACTGGTCGGTCAAT Locus tag: Mpe_A0984 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Mpe_A0985 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Mpe_A0986 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: Mpe_A0987 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Mpe_A0988 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Mpe_A0989 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Mpe_A0990 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Mpe_A0991 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Mpe_A0992 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	Mpe_A0984	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	Mpe_A0985	paaY	thioesterase superfamily protein
	Mpe_A0986	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Mpe_A0987	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Mpe_A0988	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Mpe_A0989	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Mpe_A0990	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Mpe_A0991	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Mpe_A0992	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
Position: -78 Score: 5.6 Sequence: ATTGACCGACCAGTCGGTAGAC Locus tag: Mpe_A0983 Name: paaY2 Funciton: phenylacetic acid degradation protein PaaY
	Mpe_A0983	paaY2	phenylacetic acid degradation protein PaaY

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD