Orthologous regulated operons containing Lcho_0276 gene

Properties
Regulog:	PaaR - Comamonadaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Betaproteobacteria

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Leptothrix cholodnii SP-6
Position: -48 Score: 6.29162 Sequence: ATTTACCGACCGGACGGTCAAT Locus tag: Lcho_3574 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Lcho_3573 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Lcho_3572 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Lcho_3571 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Lcho_3570 Name: null Funciton: hypothetical protein Locus tag: Lcho_3569 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Lcho_3568 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaA-paaB-paaC-paaD-Lcho_3570-paaE-paaZ	-48	6.3	ATTTACCGACCGGACGGTCAAT	Lcho_3574

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --