Regulon of PaaR in Verminephrobacter eiseniae EF01-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Veis_3950
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Comamonadaceae
Statistics of regulated genes:
- Genes	12
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By taxonomy - Comamonadaceae
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -102 Score: 5.5 Sequence: ATCTACCGCACGGTCGGTCAAT Locus tag: Veis_3942 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Veis_3943 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Veis_3944 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: Veis_3945 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Veis_3946 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Veis_3947 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Veis_3948 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Veis_3949 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Veis_3950 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family Locus tag: Veis_3951 Name: livK Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component Locus tag: Veis_3952 Name: livH Funciton: Putative branched-chain amino acid ABC transporter, permease component Locus tag: Veis_3953 Name: livM Funciton: Putative branched-chain amino acid ABC transporter, ATPase component
	Veis_3942	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	Veis_3943	paaY	thioesterase superfamily protein
	Veis_3944	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Veis_3945	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Veis_3946	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Veis_3947	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Veis_3948	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Veis_3949	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Veis_3950	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
	Veis_3951	livK	Putative branched-chain amino acid ABC transporter, substrate-binding component
	Veis_3952	livH	Putative branched-chain amino acid ABC transporter, permease component
	Veis_3953	livM	Putative branched-chain amino acid ABC transporter, ATPase component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD