Regulon of PaaR in Delftia acidovorans SPH-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Daci_0571, Daci_0807
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Comamonadaceae
Statistics of regulated genes:
- Genes	15
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By taxonomy - Comamonadaceae
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -111 Score: 6 Sequence: ATTGACCGACCGGACGGTAGGA Locus tag: Daci_0808 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	Daci_0808	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Position: -63 Score: 4.6 Sequence: ATAATCCTACCGTCCGGTCGGT Position: -59 Score: 5.7 Sequence: TCCTACCGTCCGGTCGGTCAAT Locus tag: Daci_0809 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: Daci_0810 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Daci_0811 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Daci_0812 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Daci_0813 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Daci_0814 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Daci_0809	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Daci_0810	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Daci_0811	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Daci_0812	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Daci_0813	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Daci_0814	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Position: -71 Score: 5.2 Sequence: ATTTACCGACCATTCGGTAAAT Locus tag: Daci_0568 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Daci_0569 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Daci_0570 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: Daci_0571 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family Locus tag: Daci_0572 Name: livK Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component Locus tag: Daci_0573 Name: livH Funciton: Putative branched-chain amino acid ABC transporter, permease component Locus tag: Daci_0574 Name: livM Funciton: Putative branched-chain amino acid ABC transporter, ATPase component Locus tag: Daci_0575 Name: livF Funciton: Putative branched-chain amino acid ABC transporter, permease component 2
	Daci_0568	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	Daci_0569	paaY	thioesterase superfamily protein
	Daci_0570	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Daci_0571	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
	Daci_0572	livK	Putative branched-chain amino acid ABC transporter, substrate-binding component
	Daci_0573	livH	Putative branched-chain amino acid ABC transporter, permease component
	Daci_0574	livM	Putative branched-chain amino acid ABC transporter, ATPase component
	Daci_0575	livF	Putative branched-chain amino acid ABC transporter, permease component 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD