Regulon of PaaR in Variovorax paradoxus S110

Properties
Regulator type:	Transcription factor
TF locus tag:	Vapar_1240
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Comamonadaceae
Statistics of regulated genes:
- Genes	15
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By taxonomy - Comamonadaceae
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -101 Score: 5.4 Sequence: ATTGACCGACCGTCCGGTAGAT Locus tag: Vapar_1239 Name: paaY2 Funciton: phenylacetic acid degradation protein PaaY Locus tag: Vapar_1240 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	Vapar_1239	paaY2	phenylacetic acid degradation protein PaaY
	Vapar_1240	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
Position: -52 Score: 4.6 Sequence: TAAAATCTACCGGACGGTCGGT Position: -48 Score: 5.5 Sequence: ATCTACCGGACGGTCGGTCAAT Locus tag: Vapar_1238 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Vapar_1237 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Vapar_1236 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: Vapar_1235 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Vapar_1234 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Vapar_1233 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Vapar_1232 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Vapar_1231 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Vapar_1230 Name: livK Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component Locus tag: Vapar_1229 Name: livH Funciton: Putative branched-chain amino acid ABC transporter, permease component Locus tag: Vapar_1228 Name: livM Funciton: Putative branched-chain amino acid ABC transporter, ATPase component Locus tag: Vapar_1227 Name: livF Funciton: Putative branched-chain amino acid ABC transporter, permease component 2 Locus tag: Vapar_1226 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	Vapar_1238	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	Vapar_1237	paaY	thioesterase superfamily protein
	Vapar_1236	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Vapar_1235	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Vapar_1234	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Vapar_1233	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Vapar_1232	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Vapar_1231	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Vapar_1230	livK	Putative branched-chain amino acid ABC transporter, substrate-binding component
	Vapar_1229	livH	Putative branched-chain amino acid ABC transporter, permease component
	Vapar_1228	livM	Putative branched-chain amino acid ABC transporter, ATPase component
	Vapar_1227	livF	Putative branched-chain amino acid ABC transporter, permease component 2
	Vapar_1226	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD