Regulog CopR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | CopY |
| Regulation mode: | repressor |
| Biological process: | Copper homeostasis |
| Effector: | Copper ion, (Cu2+) |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - CopY
- By effector - Copper ion, (Cu2+)
- By pathway - Copper homeostasis
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| cinD |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -72 score = 6.21831 sequence = TAGTTTACAAGTGTAAATTT Site: position = -45 score = 5.59429 sequence = AAGATTACAGATGTAAACAA Gene: LACR_2184: Copper-induced nitroreductase |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -73 score = 6.21831 sequence = TAGTTTACAAGTGTAAATTT Site: position = -46 score = 5.64158 sequence = AAGATTACATATGTAAACAA Gene: L174788: Copper-induced nitroreductase |
Gene: SAG1909: Copper-induced nitroreductase |
|
|
|
|
|
Gene: SMU.260: Copper-induced nitroreductase |
|
|
|
Gene: SSU05_1952: Copper-induced nitroreductase |
Gene: str1363: Copper-induced nitroreductase |
|
Copper-induced nitroreductase |
| CRON 2. | ||||||||||||||||
| copR |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -53 score = 5.04187 sequence = GTGTTTACGCGTGTAAACTT Gene: LACR_0889: Copper transport transcriptional regulator CopR, CopY family |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -53 score = 5.51604 sequence = GTGTTTACACGTGTAAACTT Gene: L45109: Copper transport transcriptional regulator CopR, CopY family |
*
Streptococcus agalactiae 2603V/R Site: position = -34 score = 5.2971 sequence = TGGTTTACAAACGTAAATCG Site: position = -66 score = 5.77667 sequence = CGGTTTACAAATGTAGATTT Gene: SAG0384: Copper transport transcriptional regulator CopR, CopY family |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -41 score = 6.34542 sequence = TAATTTACAAATGTAAATTA Site: position = -73 score = 5.72076 sequence = TTATTTACAAATGTAGTTAA Gene: SDEG_1771: Copper transport transcriptional regulator CopR, CopY family |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -65 score = 6.23473 sequence = TTGTTTACAAATGTAAACAA Gene: Sez_0447: Copper transport transcriptional regulator CopR, CopY family |
*
Streptococcus gallolyticus UCN34 Site: position = -43 score = 5.67741 sequence = AAATCTACAAATGTAAATCA Site: position = -75 score = 5.64334 sequence = TCGTTGACAAATGTAAACGA Gene: GALLO_0378: Copper transport transcriptional regulator CopR, CopY family |
*2
Streptococcus gordonii str. Challis substr. CH1 Site: position = -75 score = 6.12802 sequence = TTGTTTACAAATGTAAATGT Site: position = -34 score = 6.02419 sequence = AGATTTACAAATGTAGATTT Gene: SGO_0289: Copper transport transcriptional regulator CopR, CopY family Site: position = -66 score = 5.73651 sequence = GCGATTACAAATGTAAACTA Site: position = -37 score = 5.89132 sequence = TGAATTACAAATGTAAATAA Gene: SGO_1935: Copper transport transcriptional regulator CopR, CopY family |
*
Streptococcus mitis B6 Site: position = -33 score = 5.98501 sequence = TAATTGACAAATGTAGATTT Site: position = -73 score = 6.04341 sequence = TAGTTGACAAATGTAGATTT Gene: smi_1434: Copper transport transcriptional regulator CopR, CopY family |
*
Streptococcus mutans UA159 Site: position = -31 score = 5.42485 sequence = GTATCTACAAATGTAGATGA Site: position = -63 score = 5.84815 sequence = TTGTTGACAAATGTAGACAA Gene: SMU.424: Copper transport transcriptional regulator CopR, CopY family |
*
Streptococcus pneumoniae TIGR4 Site: position = -27 score = 5.98501 sequence = TAATTGACAAATGTAGATTT Site: position = -67 score = 5.98501 sequence = TAATTGACAAATGTAGATTT Gene: SP_0727: Copper transport transcriptional regulator CopR, CopY family |
*
Streptococcus pyogenes M1 GAS Site: position = -41 score = 5.94376 sequence = TAATTTACAAACGTAAATAT Site: position = -73 score = 5.72076 sequence = TTATTTACAAATGTAGTTAA Gene: SPy1717: Copper transport transcriptional regulator CopR, CopY family |
*
Streptococcus sanguinis SK36 Site: position = -66 score = 5.89132 sequence = ACGATTACAAATGTAAACTA Site: position = -37 score = 5.91704 sequence = TAGATTACAAATGTAAATGA Gene: SSA_0139: Copper transport transcriptional regulator CopR, CopY family |
*
Streptococcus suis 05ZYH33 Site: position = -34 score = 5.5369 sequence = TTGACTACAAATGTAAACTG Gene: SSU05_0113: Copper transport transcriptional regulator CopR, CopY family |
*
Streptococcus thermophilus CNRZ1066 Site: position = -100 score = 5.33022 sequence = AAATCTATAAATGTAGATAA Site: position = -46 score = 5.85756 sequence = AAATCTACAAATGTAAACAA Gene: str1586: Copper transport transcriptional regulator CopR, CopY family |
*
Streptococcus uberis 0140J Site: position = -34 score = 6.0991 sequence = ATATTTACAAATGTAAACAA Site: position = -66 score = 5.86041 sequence = ATATTTACAATTGTAGATAT Gene: SUB1464: Copper transport transcriptional regulator CopR, CopY family |
Copper transport transcriptional regulator CopR, CopY family |
| copA |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -54 score = 6.05653 sequence = AAGTTTACAATTGTAAACTA Gene: LACR_0891: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: L45966: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: SAG0385: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: SDEG_1770: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: Sez_0448: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: GALLO_0379: Copper-translocating P-type ATPase (EC 3.6.3.4) |
2
Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0291: Copper-translocating P-type ATPase (EC 3.6.3.4) Gene: SGO_1934: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: smi_1432: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: SMU.426: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: SP_0729: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: SPy1715: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: SSA_0140: Copper-translocating P-type ATPase (EC 3.6.3.4) |
6
Streptococcus suis 05ZYH33 Gene: SSU05_1386: Copper-translocating P-type ATPase (EC 3.6.3.4) Gene: SSU05_1385: Copper-translocating P-type ATPase (EC 3.6.3.4) Gene: SSU05_1384: Copper-translocating P-type ATPase (EC 3.6.3.4) Gene: SSU05_0220: Copper-translocating P-type ATPase (EC 3.6.3.4) Gene: SSU05_0221: Copper-translocating P-type ATPase (EC 3.6.3.4) Gene: SSU05_0222: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: str1585: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: SUB1463: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| copZ |
Gene: LACR_0890: Copper chaperone |
Gene: L45583: Copper chaperone |
Gene: SAG0386: Copper chaperone |
Gene: SDEG_1769: Copper chaperone |
|
Gene: GALLO_0380: Copper chaperone |
Gene: SGO_1933: Copper chaperone |
|
Gene: SMU.427: Copper chaperone |
|
Gene: SPy1714: Copper chaperone |
Gene: SSA_0141: Copper chaperone |
Gene: SSU05_0115: Copper chaperone |
Gene: str1584: Copper chaperone |
Gene: SUB1462: Copper chaperone |
Copper chaperone |
| copX |
|
|
|
Gene: SDEG_1768: Truncated copper chaperone |
|
|
|
|
|
|
|
|
|
|
|
Truncated copper chaperone |
| copA2 |
|
|
|
|
|
|
Gene: SGO_0290: Copper-exporting ATPase (EC 3.6.3.4) |
Gene: smi_1433: Copper-exporting ATPase (EC 3.6.3.4) |
|
Gene: SP_0728: Copper-exporting ATPase (EC 3.6.3.4) |
|
|
|
|
|
Copper-exporting ATPase (EC 3.6.3.4) |
| SSU05_0114 |
|
|
|
|
|
|
|
|
|
|
|
|
Gene: SSU05_0114: Hypothetical protein |
|
|
Hypothetical protein |
| CRON 3. | ||||||||||||||||
| ydiD |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -106 score = 5.77652 sequence = ATGTTTACATGTGTAAATTT Gene: LACR_0427: FMN-dependent NADH-azoreductase |
*2
Lactococcus lactis subsp. lactis Il1403 Gene: L115551: FMN-dependent NADH-azoreductase Site: position = -106 score = 5.77652 sequence = ATGTTTACATGTGTAAATTT Gene: L186107: FMN-dependent NADH-azoreductase |
|
|
|
|
|
|
|
|
|
|
2
Streptococcus suis 05ZYH33 Gene: SSU05_1570: FMN-dependent NADH-azoreductase Gene: SSU05_1569: FMN-dependent NADH-azoreductase |
|
|
FMN-dependent NADH-azoreductase |
| CRON 4. | ||||||||||||||||
| copB |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -65 score = 5.5735 sequence = AGGTTTACAATCGTAAACTT Gene: LACR_0920: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -62 score = 6.13376 sequence = TAGTTTACAATTGTAAACTA Gene: L70979: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
|
|
|
|
|
|
|
|
Gene: str0840: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| CRON 5. | ||||||||||||||||
| yahC |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -45 score = 5.92409 sequence = TCGTTTACAATTGTAAACAT Gene: LACR_0072: Hypothetical protein |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -45 score = 5.92409 sequence = TCGTTTACAATTGTAAACAT Gene: L200005: Hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Hypothetical protein |
| yahD |
Gene: LACR_0073: Copper-inducible alpha/beta serine hydrolase |
Gene: L79507: Copper-inducible alpha/beta serine hydrolase |
|
|
|
|
|
|
|
|
|
|
|
|
|
Copper-inducible alpha/beta serine hydrolase |
| yaiA |
Gene: LACR_0074: Glyoxalase family protein |
Gene: L80191: Glyoxalase family protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Glyoxalase family protein |
| yaiB |
Gene: LACR_0075: Hypothetical protein |
Gene: L81206: Hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |