Regulon of CopR in Streptococcus gordonii str. Challis substr. CH1

Properties
Regulator type:	Transcription factor
TF locus tag:	SGO_1935, SGO_0289
Regulator family:	CopY
Regulation mode:	repressor
Biological process:	Copper homeostasis
Effector:	Copper ion, (Cu2+)
Regulog:	CopR - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CopY
By effector - Copper ion, (Cu2+)
By pathway - Copper homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 5.7 Sequence: GCGATTACAAATGTAAACTA Position: -37 Score: 5.9 Sequence: TGAATTACAAATGTAAATAA Locus tag: SGO_1935 Name: copR Funciton: Copper transport transcriptional regulator CopR, CopY family Locus tag: SGO_1934 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: SGO_1933 Name: copZ Funciton: Copper chaperone
	SGO_1935	copR	Copper transport transcriptional regulator CopR, CopY family
	SGO_1934	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	SGO_1933	copZ	Copper chaperone
Position: -75 Score: 6.1 Sequence: TTGTTTACAAATGTAAATGT Position: -34 Score: 6 Sequence: AGATTTACAAATGTAGATTT Locus tag: SGO_0289 Name: copR Funciton: Copper transport transcriptional regulator CopR, CopY family Locus tag: SGO_0290 Name: copA2 Funciton: Copper-exporting ATPase (EC 3.6.3.4) Locus tag: SGO_0291 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	SGO_0289	copR	Copper transport transcriptional regulator CopR, CopY family
	SGO_0290	copA2	Copper-exporting ATPase (EC 3.6.3.4)
	SGO_0291	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD