Regulon of CopR in Streptococcus agalactiae 2603V/R

Properties
Regulator type:	Transcription factor
TF locus tag:	SAG1264
Regulator family:	CopY
Regulation mode:	repressor
Biological process:	Copper homeostasis
Effector:	Copper ion, (Cu2+)
Regulog:	CopR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CopY
By effector - Copper ion, (Cu2+)
By pathway - Copper homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 5.8 Sequence: CGGTTTACAAATGTAGATTT Position: -34 Score: 5.3 Sequence: TGGTTTACAAACGTAAATCG Locus tag: SAG0384 Name: copR Funciton: Copper transport transcriptional regulator CopR, CopY family Locus tag: SAG0385 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: SAG0386 Name: copZ Funciton: Copper chaperone
	SAG0384	copR	Copper transport transcriptional regulator CopR, CopY family
	SAG0385	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	SAG0386	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD