Regulon of CopR in Streptococcus suis 05ZYH33

Properties
Regulator type:	Transcription factor
TF locus tag:	SSU05_0113
Regulator family:	CopY
Regulation mode:	repressor
Biological process:	Copper homeostasis
Effector:	Copper ion, (Cu2+)
Regulog:	CopR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CopY
By effector - Copper ion, (Cu2+)
By pathway - Copper homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 5.5 Sequence: TTGACTACAAATGTAAACTG Locus tag: SSU05_0113 Name: copR Funciton: Copper transport transcriptional regulator CopR, CopY family Locus tag: SSU05_0114 Name: SSU05_0114 Funciton: Hypothetical protein Locus tag: SSU05_0115 Name: copZ Funciton: Copper chaperone
	SSU05_0113	copR	Copper transport transcriptional regulator CopR, CopY family
	SSU05_0114	SSU05_0114	Hypothetical protein
	SSU05_0115	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD