Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing yaiB gene

Properties
Regulog: CopR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: CopY
Regulation mode: repressor
Biological process: Copper homeostasis
Effector: Copper ion, (Cu2+)
Phylum: Firmicutes
Built upon 39 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactococcus lactis subsp. cremoris SK11
Position: -45
Score: 5.92409
Sequence: TCGTTTACAATTGTAAACAT
Locus tag: LACR_0072
Name: yahC
Funciton: Hypothetical protein
Locus tag: LACR_0073
Name: yahD
Funciton: Copper-inducible alpha/beta serine hydrolase
Locus tag: LACR_0074
Name: yaiA
Funciton: Glyoxalase family protein
Locus tag: LACR_0075
Name: yaiB
Funciton: Hypothetical protein
yahC-yahD-yaiA-yaiB -45 5.9 TCGTTTACAATTGTAAACAT LACR_0072
Lactococcus lactis subsp. lactis Il1403
Position: -45
Score: 5.92409
Sequence: TCGTTTACAATTGTAAACAT
Locus tag: L200005
Name: yahC
Funciton: Hypothetical protein
Locus tag: L79507
Name: yahD
Funciton: Copper-inducible alpha/beta serine hydrolase
Locus tag: L80191
Name: yaiA
Funciton: Glyoxalase family protein
Locus tag: L81206
Name: yaiB
Funciton: Hypothetical protein
yahC-yahD-yaiA-yaiB -45 5.9 TCGTTTACAATTGTAAACAT L200005
© 2009-2020 RegPrecise