Regulon of CopR in Streptococcus gallolyticus UCN34

Properties
Regulator type:	Transcription factor
TF locus tag:	GALLO_0378
Regulator family:	CopY
Regulation mode:	repressor
Biological process:	Copper homeostasis
Effector:	Copper ion, (Cu2+)
Regulog:	CopR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CopY
By effector - Copper ion, (Cu2+)
By pathway - Copper homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -75 Score: 5.6 Sequence: TCGTTGACAAATGTAAACGA Position: -43 Score: 5.7 Sequence: AAATCTACAAATGTAAATCA Locus tag: GALLO_0378 Name: copR Funciton: Copper transport transcriptional regulator CopR, CopY family Locus tag: GALLO_0379 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: GALLO_0380 Name: copZ Funciton: Copper chaperone
	GALLO_0378	copR	Copper transport transcriptional regulator CopR, CopY family
	GALLO_0379	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	GALLO_0380	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD