Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SSU05_0114 gene

Properties
Regulog: CopR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: CopY
Regulation mode: repressor
Biological process: Copper homeostasis
Effector: Copper ion, (Cu2+)
Phylum: Firmicutes
Built upon 39 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptococcus suis 05ZYH33
Position: -34
Score: 5.5369
Sequence: TTGACTACAAATGTAAACTG
Locus tag: SSU05_0113
Name: copR
Funciton: Copper transport transcriptional regulator CopR, CopY family
Locus tag: SSU05_0114
Name: SSU05_0114
Funciton: Hypothetical protein
Locus tag: SSU05_0115
Name: copZ
Funciton: Copper chaperone
copR-SSU05_0114-copZ -34 5.5 TTGACTACAAATGTAAACTG SSU05_0113
© 2009-2020 RegPrecise