Regulon of CopR in Streptococcus pneumoniae TIGR4

Properties
Regulator type:	Transcription factor
TF locus tag:	SP_0727
Regulator family:	CopY
Regulation mode:	repressor
Biological process:	Copper homeostasis
Effector:	Copper ion, (Cu2+)
Regulog:	CopR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CopY
By effector - Copper ion, (Cu2+)
By pathway - Copper homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 6 Sequence: TAATTGACAAATGTAGATTT Position: -27 Score: 6 Sequence: TAATTGACAAATGTAGATTT Locus tag: SP_0727 Name: copR Funciton: Copper transport transcriptional regulator CopR, CopY family Locus tag: SP_0728 Name: copA2 Funciton: Copper-exporting ATPase (EC 3.6.3.4) Locus tag: SP_0729 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	SP_0727	copR	Copper transport transcriptional regulator CopR, CopY family
	SP_0728	copA2	Copper-exporting ATPase (EC 3.6.3.4)
	SP_0729	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD